PDA

Orijinalini görmek için tıklayınız : Adem ile Havva'nın Uzun Yürüyüşü


dilaver
15-07-2008, 01:36
İnsanın tarihini anlamanın yeni ve kesin yolu:
Genlerimize bakmak

Hücrelerimizde genler bulunur. Genler, tırnaklarımızdan piyano çalma yeteneğimize kadar kim olduğumuzu belirleyen şerit benzeri bir hayat kodundan, DNA’dan oluşur. Genleri inceleyerek, atalarımızın izledikleri coğrafik yolun başlangıcının Afrika’ya, türlerimizin şafağına kadar uzandığını görebiliriz. Sonra iki kişiyi ele alıp genlerini karşılaştırdığımızda,onların daha yakın zamanlı muhtemelen Afrika’nın dışında yaşamış bir ortak ataya sahip olduğunu görebiliriz. Dahası, artık bu ataların nerede yaşadıkları ve anayurtlarını ne zaman terk ettikleri de kanıtlanabilir. Bu dikkate değer kanıtlar, birçok insanın çığır açan çalışmalarının sonucu olarak, sadece geçtiğimiz on yılda mümkün olabilmiştir.

İçimizden birçoğu bir zaman makinesi icat edip atalarımızın yaşadıkları zamana yolculuk yaptığımızda neler bulabileceğimizi merak etmiştir. Bu makine bizi nereye götürecekti? Kendimizi herhangi bir ünlü ve saygıdeğer insanla uzaktan akraba bulabilecek miydik? İlk insanlara ulaşmak için kaç kuşak geçmemiz gerekecekti? Darwin’in iddia ettiği gibi soyağacımız maymunlara ve onun da ötesinde solucanlara ve tekhücreli varlıklara mı uzanıyordu? Okuldaki biyoloji derslerinden bunun böyle olması gerektiğini biliyoruz, ama tıpkı öldükten sonra ne olacağımız konusu gibi, bu konuyu da tam anlamıyla kavramak güç.

Teknolojik gelişmelerde atılan adımlara o kadar alıştık ki, her yeni adımda kafamızdaki acaba soruları azalıyor. Çok yakın bir tarihe kadar, genetik bilimciler, bizim dünyayı nasıl fethettiğimizin ayrıntılı tarihini çizmek için genlerden faydalanmayı ancak rüyalarında görebilirlerdi. Onların kötümser olmalarının nedeni, inceledikleri genlerin büyük kısmının her kuşakta birbirine karışması ve toplumların çoğunda ortak olarak görülmesiydi. Onlarıngörevleri daha önce oynanmış bir iskambil oyununu, karıştırıldıktan sonraki haliyle bir kâğıt destesinden yeniden yaratmaya çalışmaktı. Dolayısıyla değil türlerimizin başladığı zamana, birkaç yüzyıl öncesine giden bir genetik soyağacını doğru bir şekilde çıkarmak bile neredeyse imkânsızdı. İnsanların çoğu derilerinin altında birbirine çok benziyordu,o zaman nereden başlanabilirdi?

Adem ile Havva genetik soyağacı

Adem ile Havva kolları diye adlandırılan cinslere özgü genetik kolların kullanımı, geçtiğimiz on yılda her şeyi değiştirdi. Bütün diğer genlerden farklı olarak, mitokondriyal DNA (hücre çekirdeğinin dışındaki bir gen koleksiyonu) bize sadece annelerimizden kalır, Y kromozomu da sadece erkeklerden. Bu iki cinse bağlı gen seti hiçbir karışma olmadan kuşaktan kuşağa değişmeden aktarılır ve böylece atalarımıza, ilk primatlara kadar izlenebilir. Böylece biri annelerimizden biri de babalarımızdan olmak üzere iki ailevi genetik soyağacı kurabiliriz. Sonuç olarak, herhangi bir toplulukta, bu topluluk ne kadar geniş olursa olsun, bu iki genetik soyağacı yoluyla herhangi iki bireyi izleyip ağaçtaki en yakın ortak atalarına ulaşabiliriz. Bu ata 1500 ya da 150 binyıl önce yaşamış olabilir ama, bütün atalara bu yeni kurulmuş Adem ve Havva genetik soyağacında bir yer ayrılabilir. Bunlar, modern insanın genetik kollarının gerçek dalları olan gerçek ailevi soyağaçlarıdır.

Her ağaçtaki dalların her biri tarihlenebilir (Her ne kadar bu tarihlerin doğruluğu tam olarak kesinlik kazanamamış olsa da). Birçok bölgesel insan soyağacı, belli açık sınır işaretleri kullanarak kenarların birleştirilmesi yoluyla tıpkı bir yapboz gibi birbirine uyumlu hale getirilmiştir. Böylece Afrika’dan dünyanın her köşesine yayılan bir Adem ile Havva genetik dalları resminin parçaları geçtiğimiz on yılda bir araya getirilmiştir. Sonunda bütün yapının parçaları arasında bir bağ oluşup anlam kazanmaya başladığında, tıpkı yapbozda olduğu gibi tatmin edici bir görünüm elde ediliyor; kalan parçalar ne kadar çok olursa olsun, artık ağacın ve haritanın üzerine giderek artan bir kolaylık ve hızla yerleştirilebiliyor. Bütün dallarıyla ağaç artık dünya haritasının üzerine yayılıp, atalarımız ve onların genetik kollarının dünyayı fethederken nerelerden geçtiklerini gösterebilir.

Elde edilen yeni bilgiler, son 150 binyılın kültürel ve biyolojik öyküsündeki
çelişkilerin bazılarını çözmüştür. Öyle ki, o dönemin bölgesel insan fosili kalıntılarını bile hayatın genetik ağacında doğru yerlere yerleştirebiliriz.

Birçok sorunun yanıtı bulunmuştur.Elde edilen sonuca göre, dünyanın
yoğun ileri geri prehistorik hareketler ve karışmalarla ortak bir genetik döküm potası olması şöyle dursun, modern insan yayılımında rol alan insanların çoğu tutucu bir şekilde ilk defa atalarının kurduğu kolonilere sıkışıp kaldılar. Bu yerlerde Son Buzul Çağı’nın öncesinden beri ikamet etmektedirler. Ayrıca son 80 binyılın spesifik göçlerinin tarihlerini de belirleyebiliriz.

Hepimizin kökeni Afrika

Uzun süredir uğraşılan başka birçok arkeolojik sorun, yeni genetik soyağaçlarıyla çözülmüştür. Bunlardan biri “Afrika-kökenlilik” (Out of Africa) ile “Çok-bölgelilik” (Multiregional) teorileri arasındaki çatışmadır.

Afrika-kökenlilik görüşünü destekleyenler, Afrika dışındaki bütün modern insanların 100.000 yıl önce Afrika’dan yayılan bir göçten geldikleri kanaatindedir. Bu büyük göçün sonucunda dünyadaki daha eski bütün insan tipleri yeryüzünden silinmiştir. Çok-bölgelilik teorisini savunanlar ise, Avrupa’daki Neanderthaller ve Uzakdoğu’daki Homo Erectuslar gibi eski insan tiplerinin şimdi bütün dünyada gördüğümüz yerel ırklara doğru evrim geçirdiklerini öne sürer.

Şimdi yarışmayı kazananın Afrika-kökenlilik görüşü olduğu anlaşılmıştır;
çünkü yeni genetik soyağaçları son 100.000 yıl içinde doğrudan Afrika’ya uzanmaktadır. Daha eski insan türlerinden kalan Adem ile Havva genetik kollarının hiçbiri bizim genetik soyağacımızda bulunmuyor,elbette bizim Neanderthaller’den farkımızı ölçebileceğimiz ağacın kökeni hariç. Neanderthaller’in eski mitokondriyal DNA kullandıkları tespit edilmiş, genetik açıdan öyle sınıflandırılmışlardır ve görünen o ki, bizim atalarımızdan ziyade kuzenlerimizdirler. Onlarla bir başka ortak atayı paylaşıyoruz: Homo helmei.

Kimi Afrika-kökenlilik teorisi taraftarları ise, Avustralyalılar, Asyalılar
ve Avrupalıların ayrı Homo sapiens göçleri halinde Afrika’dan yayıldıklarını iddia etmişlerdir. Oysa durum böyle değildir: Eril ve dişil genetik soyağaçları Afrika’dan yayılan sadece bir tek dalı gösteriyor. Modern insanların Afrika’dan dışarı sadece bir tek büyük göçü olmuştu;her cinsel dalın, Afrikalı olmayan bütün herkesin annesi ve babası olan bir tek ortak genetik atası vardı.

“Üstün Avrupalı” tezi çürütüldü

Başka önyargılar da oluşmuştu. Bazı Avrupalı arkeolog ve antropologlar,
Avrupalılar’ın sanki büyük bir biyolojik gelişme göstermişler gibi, resim yapmayı, oymayı, karmaşık bir kültür geliştirmeyi ve hatta konuşmayı ilk öğrenenler olduklarını iddia ettiler. Genetik soyağacının yapısı bu görüşü çürütüyor. Avustralyalı Aborjinler Avrupalılar’la akrabadır ve 85.000 yıl önce Afrika’dan göçün hemen ardından ulaşılan Yemen’e kadar ortak bir ataya sahiptirler. Ondan sonra Hint Okyanusu’nun kıyı çizgisi boyunca sürekli ilerlediler, adadan adaya atlayarak Avustralya’ya gelip orada tamamen izole bir halde kendi özel ve karmaşık sanatsal kültürlerini geliştirdiler. Avustralya’daki ilk kaya sanatının tarihi ilk Avrupa sanatı kadar eskidir.

Bir başka arkeolojik tartışma Neolitik kültürün 8000 yıl önce Avrupa’ya
Türkiye’den yayılmasıyla ilgilidir. Yakındoğu’nun çiftçileri Avrupalı avcıları yok edip yerlerini mi aldılar, yoksa yeni fikirler daha barışçıl bir şekilde yayılıp daha önceki Paleolitik avcı-toplayıcı toplumları dönüştürdü mü? Genetik yanıt çok açıktır: Modern Avrupalılar’ın yüzde 80’i eski avcı-toplayıcı gen tiplerinden ve sadece yüzde 20’si Yakındoğulu çiftçilerden türemiştir.

Sonunda, dünyanın öbür ucuna gittiğimizde, Polinezyalılar’ın kökeni konusunda da renkli tartışmalar yaşanmıştır. Geçtiğimiz 15 yıl boyunca arkeologlar Polinezyalılar’ın Tayvan’dan geldiklerini düşündüler. Genetik soyağacı bu düşünceyi çürütüyor. Muhteşem kanoları sürenlerin atalarının soyu daha öteye, Doğu Endonezya’ya dayanıyor.

Hepimizin bu genetik hikâyenin bir parçası olduğunu unutmamalıyız;
nitekim eski genetik soyağacımızın yeniden oluşturulma çalışmasının yüzde 99’u bugün dünyanın değişik bölgelerinde yaşayan insanların gönüllü olarak verdikleri modern DNA’larla gerçekleştirilmiştir. Bu hepimizle ilgili bir hikâyedir.

Not : Bilim ve Gelecek Dergisi'nin 48. sayısında yer alan bu uzun dosyayı kaynak olması açısından makalelere bölerek buraya alıyorum.
http://www.evrim-teorisi.org/forum/images/misc/progress.gif

dilaver
15-07-2008, 01:37
Genetikten arkeolojiye ve antropolojiye katkı

Artık birçok antropolog bizim Afrika’dan geldiğimizi iddia ediyor, ama bunu nereden biliyorlar? Eğer bizim orada bir tek kökenimiz varsa, neden birbirinden farklı insan ırkları var? Bu ırklar birbiriyle ne kadar yakın akraba? Hepimiz bir tek ailenin parçası mıyız, yoksa Afrikalılar, Avustralyalı Aborjinler, Avrupalılar ve Doğu Asyalılar, farklı paralel kökenlerden mi geliştiler? Evrim hikâyemizde ağaçları terk eden maymunlardan gelenlerin Afrika savanlarında yürümelerini ve birkaç milyon yılda Ay’a kadar gitmelerini sağlayan anahtar güçler nelerdi?

DNA analizleri modern insanların bölgesel biyolojik tarihi konusundaki
anlayışımızda olağanüstü bir ilerlemeye neden oldu. Adem ile Havva adı takılmış genler, zaman ve mekânda ilerleyip, 200.000 yıl boyunca insan ailesini önce Afrika ve sonra yeryüzündeki yolculuklarında takip etmemizi sağlıyor.

Geçmiş 2,5 milyon yılın insan tarihinin çoğu fosil kemiklerinin ve geçmişteki iklim koşullarının incelemeleriyle oluşturuldu. Biri hariç bütün insan türleri yok oldu, bazıları çok uzun zaman önce; dolayısıyla onları inceleyecek canlı genlerine sahip değiliz.

Bununla birlikte, geçmiş insan türlerinden kalan hiçbir genin bulunmadığını söylemek gerçeği yansıtmıyor. Bizim çekirdek genlerimizin çoğu neredeyse eksiksiz olarak eski insanlar ve maymunlardan gelmektedir. Bazı insan genleri, Homo sapiensler dünyada ortaya çıkmadan çok önce birbirinden ayrılmış çeşitli formlarda bulunabilir. Bilim insanları ayrıca Neanderthal kemiklerinden küçük parçalar halinde kısa mitokondriyal DNA örnekleri çıkardılar; şu anda bizim onlarla ne derece yakın akraba olduğumuz ve modern insan topluluklarında onlardan kalan genlerin bulunup bulunmadığı sorularına yanıt verebilecek durumdalar.

dilaver
15-07-2008, 01:39
Üzgün ifadeli, uyanık bir yüz, yassı bir burun ve özellikle hızla büyüyen bir beyinle, Homo erectus, boynundan aşağısında tıpkı bizim gibiydi. Taş aletleri vardı. Başta basitçe rötuşlanmış taşlar, ama sonra daha sofistike el baltaları. Onların Afrikalı atası Homo ergaster Afrika’yı 1,95 milyon yıl önce terk eden ilk insandı, Asya’da Homo erectus adını aldı. Bu sonuncusu bizden biraz daha kısa boyluydu ve Ortadoğu’ya, Rusya’ya, Hindistan’a, Uzakdoğu’ya ve güneydoğu Asya’ya, beraberlerinde “taş-alet” teknolojisini de götürerek hızla yayıldı.

Bazı tartışmalı iddialar, ağaçtaki daha kısa boylu ata Homo habilis’in de aynı anda bu adımı attığı yönündedir. Bununla birlikte, bütün birbirini izleyen insan türlerinin buzul çağları arasındaki ilk elverişli ılık dönemde Afrika’nın dışına yayıldığına dair daha güçlü kanıtlar vardır. Homo erectus tipleri sonradan neredeyse bir milyon yıl boyunca dünyada egemen oldular. Ta ki bir milyon yıl önce yeni bir korkunç buzul çağı serisi Afrika’nın çoğunu kurutup, yeni ve daha özel bir ailenin doğuşuna neden olana dek. Bu yeni modelin ilk Afrikalı temsilcisi Homo rhodesiensis’ti. Bizimle aynı boyda, 1250 cm3 beyin hacmiyle, Acheulian adı verilen, ismini ilk bulundukları Fransız köyünden alan daha sofistike aletler kullandılar. Acheulian aletleri gözyaşı şekli oluşturacak biçimde uçları olan iki tarafı yontulmuş geniş yassı taşlardan uçları olan el baltalarından oluşuyordu. Bu yeni gelenler yaklaşık bir milyon yıl önce kısa süreli bir ılık dönemde, önce Afrika’dan Avrupa’ya muhtemelen Çin’e kadar ulaştılar ve Acheulean teknolojisini beraberinde taşıdılar.

Sonra 350.000 yıl önce, bir başka çetin Buzul Çağı yaşandı ve belki yeni bir geniş beyinli insan tipini 300.000 yıl önce Afrika sahnesine çıkardı. Kimileri
bunları arkaik Homo sapiensler, kimileri de Homo helmei olarak adlandırır. Karışıklığı önlemek için ikinci ismi kullanalım. Sarkık kaşlı, bizimle aynı boyda ve

Diğer insan türleri de Afrika kökenli

Bununla birlikte, insanın genetik prehistoryasının anlaşılmasındaki gerçek devrim son 200.000 yılı kapsıyor, burada bizi ilgilendiren de budur. Bu dönem için, yeni genetik bulgular, daha önce Avrupa ve Afrika’dan taş aletlerin ve birkaç yanlış tarihlendirilmiş iskelet kalıntısının egemen olduğu tartışmalı bir alanda, güçlü bir ışık gibi parlamıştır.

Vücudumuzun her bir hücresinde inanılmaz uzunlukta DNA şeritlerimiz vardır. Bu, genlerin maddesidir. Bütün kendimize özgü karakteristik özelliklerimizi, genetik mirasımızı depolar, kopyalar ve aktarır. Bu DNA şeritleri vücutlarımızın
yapıtaşları olan proteinler için örnek kodları barındırır. Kodlar, vücutlarımızın yapısı hakkında bütün bilgileri sağlayan (A, G, C ve T harfleriyle temsil edilen) dört farklı kimyasalın kombinasyonları halinde “yazılmıştır”. Ebeveynlerimizin
her birinden bize DNA miras kalır ve ikisinin kendimize has bir karışımını elde ettiğimizden dolayı, her birimizin diğer herkesten farklı DNA şeritleri vardır. Kendi DNA’mız moleküler bir parmak izi gibidir.

a ACTTTCAATGGGTGTATCCTAGGGTGTACATATTTACT
b ACTTTCAATGAGTGTATCCTAGGGTGTACATATTTACT
c ACTTTCAATGGGTGTATCCTAGGGTGTATATATTTACT
d ACTTTCAATGAGTGTATCCTAGGGTGTACATACTTACT


İnsanların üremesi sırasında, ebeveynlerin DNA’ları eşit oranlarda kopyalanıp aktarılır. Şunu bilmek gerekir: Her ne kadar her ebeveynden gelen DNA’nın çoğu üreme sırasında dikkatle tasnif edilse de, onların karşılıklı ufak katkıları her kuşakta birbirine karışıp kaynaşmıştır. Bu yapışma ve kaynaşma teknik
olarak yeniden birleşme diye bilinir ve bu genlerde genetik prehistoryamızın
izini sürmemizi daha da zorlaştırır. Ne mutlu ki, genetik araştırmacıların
yararına, DNA’mızın yeniden karışmayan iki küçük kısmı vardır. Bilgiler kuşaktan kuşağa aktarılırken bozulmadıkları için bu karışmamış DNA’nın geçmiş haritasını
çıkarmak daha kolaydır. Bu iki kısım, mitokondriyal DNA (mtDNA) ile Y kromozomunun karışmayan kısmı olarak bilinir.

bizimkinden hafifçe daha geniş olan 1400 cm3’lük ortalama beyin hacmine sahiptiler. Orta Paleolitik adı verilen en önemli devrimlerden birini aşlatmışlardı.
Bazıları bu kalın kaşlı varlıkların, eğer modern bir ailede doğsalardı bizim toplumumuza uyum sağlayabileceklerini iddia edecek kadar ileri gittiler.

Bir ılık dönem boyunca, daha büyük çapta ve daha uzun süren bir Afrika dışı hareket, Homo helmei’nin 250.000 yıl önce Avrasya’da yayılmasına neden oldu.
Homo helmei Avrupa’da ve Asya’da Homo neanderthalensis’in doğmasına neden olmuş olabilir ve belki aynı dönemde Hindistan’da ve Çin’de akrabaları bulunuyordu. Bizim atalarımızı içeren ana insan ailesi ise Afrika’da kaldı, zamanla Avrupa’daki Neanderthal kuzenlerinden fiziksel açıdan ayrıldı.

Bizim türümüz Homo sapiens, 170.000 yıldan daha uzun bir süre önce doğdu ve sonra buzul çağlarının en büyüklerinin birinde, nüfusu 10.000’e düşüp nesli yok olma noktasına geldi. Her ne kadar Homo sapiensler gerektiği gibi bir sonraki ılık dönemde Afrika’dan çıkıp Doğu Akdeniz’e gittilerse de, genetik kanıtlar sonraki Buzul Çağı’nda soylarından gelenlerin orada halef bırakmadan öldüklerini gösteriyor. Sonunda 70.000-80.000 yıl önce modern insan türleri Afrika’nın dışına yayıldığında, Avrasya’da hâlâ diğer insan türlerinden örnekler bulunuyordu. Avrupalı Neanderthaller ve muhtemelen Güneydoğu Asyalı Homo erectus, yaklaşık 30.000 yıl öncesine kadar yaşam savaşı verdiler ama,
onların hiçbir genetik izi yaşayan insanlara kalmadı.

Yandaki diyagram tek mutasyonlu gen soyağaçlarını gösteriyor. I = mutasyon

3,5 milyon yıl önce

Australopithecus afarensis Afrika’da yaşadı, iki ayak üstünde durup yürüdü, ama çoğunlukla ağaçlarda yaşadığı düşünülüyor.

2 milyon yıl önce

Paranthropus boisei Afrika’da yaşadı, bizimkinden dört kat daha geniş dişleri sert bitkileri yemelerine olanak tanıyordu.

2 milyon yıl önce

Afrika’da 2 milyon yıl önce Homo habilis de yaşadı. Zeki leşçiller ve alet yapıcılardı. Modern insanların muhtemel atalarıydılar.

1,5 milyon yıl önce

Homo ergaster 1,5 milyon yıl önce Afrika’da yaşadı. Daha önceki hominidlere nazaran daha geniş beyinleri vardı ve daha yetenekli alet yapıcı ve avcılardı. İnsanların muhtemel atalarıdır. Asya’ya yayılıp orada Homo erectus olarak bilindiler.

500.000 yıl önce

Homo heidelbergensis 500.000 önce Avrupa’da yaşadı. Sofistike alet yapıcılar ve sert avcılardı. Modern insanın değil ama, Neanderthaller’in muhtemel atalarıdır.

200.000 yıl önce

Homo neanderthalensis 200.000 ila 30.000 yılları arasında yaşadı. Geçtiğimiz Buzul Çağı’nın büyük bölümünde Avrupa’da egemen hominid türüydü. Modern insan Homo sapiensler tarafından sürüldüler.

dilaver
15-07-2008, 01:40
Mitokondriyal DNA: Havva geni

Genlerimizin yarısını annemizden yarısını da babamızdan aldığımız tamamıyla doğru değildir. DNA’mızın küçücük bir kısmı, sadece anne tarafından iner. Buna
mitokondriyal DNA denir. Çünkü bu, mitokondriya adı verilen küçük tüp şeklindeki paketlerin içinde tek bir dairesel şerit halinde bulunur. Bunlar hücre sitoplazmasında pil işlevi görürler. Bazı moleküler biyologlar, ölçülemeyecek kadar uzun süre önce, mitokondriyonların kendi DNA’larını içeren yaşayan
organizmalar olduklarını ve enerji üretmenin sırrına sahip olduklarını söylüyor. Bunlar tekhücre çekirdekli organizmaları istila ettiler ve o zamandan beri orada kaldılar ve maya gibi ortadan ikiye bölündüler. Erkekler, her ne kadar annelerinin mitokondriyal DNA’larını alıp kullansalar da, bunları çocuklarına
geçiremezler. Spermin vajinadan yumurtaya uzun yolculuğunu gerçekleştiren
kendi mitokondriyası vardır, ama yumurtaya girişte, eril mitokondriya bozulur ve ölür. Bu bir erkeğin silahlarını kapıda bırakmak zorunda kalması gibidir.

Dolayısıyla her birimiz annemizden kendi mtDNA’mızı alırız, o da kendi tDNA’sını annesinden almıştır ve kuşaklar boyunca böyle sürüp gitmiştir, bu nedenle
mtDNA’nın popüler ismi “Havva geni”dir. Nihayetinde, bugün yaşayan herkes kendi mitokondriyal DNA’sını yaklaşık 200.000 yıl önce tek bir büyük büyük büyük büyük ... büyükanneden almıştır. Bu mtDNA, DNA mirasının devamlı yer
değiştiren kumları arasında ender bir sabit nokta gibidir. Bununla birlikte,
şayet bugün dünyada bulunan Havva kromozomları, orijinal Havva mtDNA’sının eksiksiz kopyasıysa,o zaman hepsinin açıkça birbirinin aynı olması gerekirdi. Bu bir mucize olurdu, ama bu, ayrıca mtDNA’nın bize prehistoryamız hakkında yeterli bilgi veremeyeceği anlamına gelirdi. Bütün kadınların tek bir ortak
Havva’ya dayanıyor olabileceği fikri heyecan uyandırıcı, ama kızlarının
değişik hayatlarını takip etmemiz için bize ayrıntılı bilgi vermiyor. Bize çeşitliliği olan bir şeyler lazım.

DNA noktası değişiklikleri burada devreye giriyor. MtDNA annemizden bize geçerken, ntDNA kodunun bir veya daha fazla “harfinde” bir değişiklik veya mutasyon olmaktadır. Her bin kuşakta bir değişiklik. Nokta mutasyonu (point
mutation) adı verilen yeni harf, sonraki kızlara aktarılmış olacaktır. Her ne kadar tek bir aile dalında mutasyon olması ender rastlanan bir olay olsa da, annelerin kız çocuk sayısıyla doğru orantılı olarak mutasyon olması ihtimali de o kadar artmaktadır.Dolayısıyla bir kuşakta, bir milyon annenin her birinin, geri kalandan farklı yeni bir mutasyon geçirmiş binden fazla kızı olabilir. Bu
nedenle 10.000 yıldan önce ortak bir anne ataya sahip olmadıkça,etrafımızdaki
herkesten farklı olan bir kodumuz vardır.

Bir ağacı oluşturmak için mutasyonlardan faydalanmak

Neredeyse 200.000 yıl süren bir dönem boyunca, bir sürü küçük rasgele mutasyon, bütün dünyadaki Havva kızlarına geçmiş olan farklı insan mtDNA moleküllerinde toplanmıştır. Her birimiz için, bu, kendi kişisel Havva kaydımızda 7 ila 15 mutasyon bulunduğu anlamına gelir. Mutasyonlar böylece, kendi
maternel prehistoryamız hakkındaki bilgiyi toplayan birer dosyadırlar. DNA’nın ana görevi kendini her yeni kuşağa kopyalamaktır. Bu mutasyonları mtDNA’nın genetik bir soyağacını oluşturmak için kullanabiliriz, çünkü müstakbel annenin
yumurtasındaki her yeni mtDNA mutasyonu dişil soy boyunca sürekli olarak bütün haleflerine taşınacaktır. Böylece her dişil soy, hem yeni mutasyonlar hem de eski mutasyonlarla tanımlanmıştır. Sonuç olarak, dünyadaki bütün yaşayan kadınların değişik mutasyon kombinasyonlarını bildiğimizde, ilk annemize kadar uzanan bir aile ağacını doğal olarak oluşturabiliriz.

Her ne kadar, bir zarfın arkasında sadece birkaç mutasyonla yakın tarihli bir mtDNA ağacı çizmek kolay olsa da, binlerce mutasyon geçiren bütün insan ırkı söz konusu olduğunda sorun daha karmaşık bir hal alıyor. Dolayısıyla yeniden
ağacı oluşturmak için bilgisayarlar kullanılmaktadır. Biyologlar soy çizgisini, bugün yaşayan insan örneklerinin DNA kodlarına bakarak ve kuşaktan kuşağa aktarılırken bu kodun uğradığı değişiklikleri bir araya toplayarak, uzaktaki ortak bir ataya kadar uzatabilmektedirler. MtDNA’yı sadece anneden aldığımıza
göre, bu soy çizgisi insan türlerindeki dişil jenealojinin (soybilim) bir resmidir. Sadece ağacı yeniden çizebilmekle kalmıyoruz, örnek alınan insanların nereden geldiklerine bakarak, bazı mutasyonların nerede gerçekleştiğini bulabiliyoruz
- Örneğin Avrupa veya Asya veya Afrika. Üstelik değişiklikler (her ne kadar rasgele olsa da) statik olarak tutarlı bir oranda meydana geldiğinden,
bunların oldukları zamanı az çok tahmin edebiliriz. Böylece 90’ların sonu ve yeni yüzyılda bizim için, geçmişteki antropologların ancak hayal edebildikleri bir şeyi yapmak mümkün olmuştur: Artık modern insanların yerküremizdeki göçünün izlerini sürebiliyoruz. Elde edilen sonuca göre, mtDNA’mızda en eski değişiklikler Afrika’da 150-190.000 yıl önce gerçekleşmiştir. Sonra yeni mutasyonlar Asya’da yaklaşık 60-80.000 yıl önce görülmeye başlanmıştır. Bu bize modern
insanların Afrika’da geliştiklerini ve bazılarımızın 80.000 yıl öncesinde Afrika’dan Asya’ya göç ettiğini gösteriyor.

Bunun farkına varmak önemlidir, çünkü bireysel mutasyonların rasgele luşundan dolayı, tarihler ancak yaklaşık olarak bulunmaktadır. İnsanların göçlerini tarihlendirmenin, başarı oranı değişen bir şekilde denenmiş çeşitli matematiksel
yolları vardır; ama sadece 1996’da uygulanan bir yöntem zaman testini kazanmıştır. Bu yöntem, genlerin her dalını bu dalın dişil tiplerindeki yeni mutasyon sayısının ortalamasını alarak tarihlendirmektedir.


DNA ağacındaki moleküllerin tarihinin izini sürme konusunda “Phylogeography” adlı bu yeni yaklaşımı, on yıllar boyunca kullanılan ve klasik toplum genetiği (population genetics) olarak bilinen insan toplumlarının tarihinin matematiksel
incelemesinden ayırt etmek önemlidir. Bu iki bilim dalı aynı Mendel biyolojik ilkeleri üzerine kuruludur, ama oldukça farklı amaç ve tahminleri vardır ve bu fark, birçok yanlış anlamanın ve tartışmanın kaynağıdır. Bunu açıklamanın en kolay yolu şudur: Phylogeography bireysel DNA moleküllerinin prehistoryasını inceler, toplum genetiği ise toplumların prehistoryasını. Başka bir yolla ifade
edilirse, her insan toplumu herhangi bir özel DNA molekülünün birçok versiyonunu içerir, bunların her birinin kendi tarihi ve farklı bir kökeni vardır. Her ne kadar insan prehistoryasına bu iki yaklaşım tamamen aynı şeyi temsil edemese de, onların ortak amacı insanların göçlerinin izini sürmektir. Taşıdığımız bireysel moleküllerin izini sürmek, bir bütün halinde grupların izini sürmeye çalışmaktan çok daha kolaydır.

Genlerimizin yarısını annemizden yarısını da babamızdan aldığımız tamamıyla doğru değildir. DNA’mızın küçücük bir kısmı, sadece anne tarafından iner. Buna
mitokondriyal DNA denir. Çünkü bu, mitokondriya adı verilen küçük tüp şeklindeki paketlerin içinde tek bir dairesel şerit halinde bulunur. Bunlar hücre sitoplazmasında pil işlevi görürler. Bazı moleküler biyologlar, ölçülemeyecek kadar uzun süre önce, mitokondriyonların kendi DNA’larını içeren yaşayan
organizmalar olduklarını ve enerji üretmenin sırrına sahip olduklarını söylüyor. Bunlar tekhücre çekirdekli organizmaları istila ettiler ve o zamandan beri orada kaldılar ve maya gibi ortadan ikiye bölündüler. Erkekler, her ne kadar annelerinin mitokondriyal DNA’larını alıp kullansalar da, bunları çocuklarına
geçiremezler. Spermin vajinadan yumurtaya uzun yolculuğunu gerçekleştiren
kendi mitokondriyası vardır, ama yumurtaya girişte, eril mitokondriya bozulur ve ölür. Bu bir erkeğin silahlarını kapıda bırakmak zorunda kalması gibidir.

Dolayısıyla her birimiz annemizden kendi mtDNA’mızı alırız, o da kendi tDNA’sını annesinden almıştır ve kuşaklar boyunca böyle sürüp gitmiştir, bu nedenle
mtDNA’nın popüler ismi “Havva geni”dir. Nihayetinde, bugün yaşayan herkes kendi mitokondriyal DNA’sını yaklaşık 200.000 yıl önce tek bir büyük büyük büyük büyük ... büyükanneden almıştır. Bu mtDNA, DNA mirasının devamlı yer
değiştiren kumları arasında ender bir sabit nokta gibidir. Bununla birlikte,
şayet bugün dünyada bulunan Havva kromozomları, orijinal Havva mtDNA’sının eksiksiz kopyasıysa,o zaman hepsinin açıkça birbirinin aynı olması gerekirdi. Bu bir mucize olurdu, ama bu, ayrıca mtDNA’nın bize prehistoryamız hakkında yeterli bilgi veremeyeceği anlamına gelirdi. Bütün kadınların tek bir ortak
Havva’ya dayanıyor olabileceği fikri heyecan uyandırıcı, ama kızlarının
değişik hayatlarını takip etmemiz için bize ayrıntılı bilgi vermiyor. Bize çeşitliliği olan bir şeyler lazım.

DNA noktası değişiklikleri burada devreye giriyor. MtDNA annemizden bize geçerken, ntDNA kodunun bir veya daha fazla “harfinde” bir değişiklik veya mutasyon olmaktadır. Her bin kuşakta bir değişiklik. Nokta mutasyonu (point
mutation) adı verilen yeni harf, sonraki kızlara aktarılmış olacaktır. Her ne kadar tek bir aile dalında mutasyon olması ender rastlanan bir olay olsa da, annelerin kız çocuk sayısıyla doğru orantılı olarak mutasyon olması ihtimali de o kadar artmaktadır.Dolayısıyla bir kuşakta, bir milyon annenin her birinin, geri kalandan farklı yeni bir mutasyon geçirmiş binden fazla kızı olabilir. Bu
nedenle 10.000 yıldan önce ortak bir anne ataya sahip olmadıkça,etrafımızdaki
herkesten farklı olan bir kodumuz vardır.

Bir ağacı oluşturmak için mutasyonlardan faydalanmak

Neredeyse 200.000 yıl süren bir dönem boyunca, bir sürü küçük rasgele mutasyon, bütün dünyadaki Havva kızlarına geçmiş olan farklı insan mtDNA moleküllerinde toplanmıştır. Her birimiz için, bu, kendi kişisel Havva kaydımızda 7 ila 15 mutasyon bulunduğu anlamına gelir. Mutasyonlar böylece, kendi
maternel prehistoryamız hakkındaki bilgiyi toplayan birer dosyadırlar. DNA’nın ana görevi kendini her yeni kuşağa kopyalamaktır. Bu mutasyonları mtDNA’nın genetik bir soyağacını oluşturmak için kullanabiliriz, çünkü müstakbel annenin
yumurtasındaki her yeni mtDNA mutasyonu dişil soy boyunca sürekli olarak bütün haleflerine taşınacaktır. Böylece her dişil soy, hem yeni mutasyonlar hem de eski mutasyonlarla tanımlanmıştır. Sonuç olarak, dünyadaki bütün yaşayan kadınların değişik mutasyon kombinasyonlarını bildiğimizde, ilk annemize kadar uzanan bir aile ağacını doğal olarak oluşturabiliriz.

Her ne kadar, bir zarfın arkasında sadece birkaç mutasyonla yakın tarihli bir mtDNA ağacı çizmek kolay olsa da, binlerce mutasyon geçiren bütün insan ırkı söz konusu olduğunda sorun daha karmaşık bir hal alıyor. Dolayısıyla yeniden
ağacı oluşturmak için bilgisayarlar kullanılmaktadır. Biyologlar soy çizgisini, bugün yaşayan insan örneklerinin DNA kodlarına bakarak ve kuşaktan kuşağa aktarılırken bu kodun uğradığı değişiklikleri bir araya toplayarak, uzaktaki ortak bir ataya kadar uzatabilmektedirler. MtDNA’yı sadece anneden aldığımıza
göre, bu soy çizgisi insan türlerindeki dişil jenealojinin (soybilim) bir resmidir. Sadece ağacı yeniden çizebilmekle kalmıyoruz, örnek alınan insanların nereden geldiklerine bakarak, bazı mutasyonların nerede gerçekleştiğini bulabiliyoruz
- Örneğin Avrupa veya Asya veya Afrika. Üstelik değişiklikler (her ne kadar rasgele olsa da) statik olarak tutarlı bir oranda meydana geldiğinden,
bunların oldukları zamanı az çok tahmin edebiliriz. Böylece 90’ların sonu ve yeni yüzyılda bizim için, geçmişteki antropologların ancak hayal edebildikleri bir şeyi yapmak mümkün olmuştur: Artık modern insanların yerküremizdeki göçünün izlerini sürebiliyoruz. Elde edilen sonuca göre, mtDNA’mızda en eski değişiklikler Afrika’da 150-190.000 yıl önce gerçekleşmiştir. Sonra yeni mutasyonlar Asya’da yaklaşık 60-80.000 yıl önce görülmeye başlanmıştır. Bu bize modern
insanların Afrika’da geliştiklerini ve bazılarımızın 80.000 yıl öncesinde Afrika’dan Asya’ya göç ettiğini gösteriyor.

Bunun farkına varmak önemlidir, çünkü bireysel mutasyonların rasgele luşundan dolayı, tarihler ancak yaklaşık olarak bulunmaktadır. İnsanların göçlerini tarihlendirmenin, başarı oranı değişen bir şekilde denenmiş çeşitli matematiksel
yolları vardır; ama sadece 1996’da uygulanan bir yöntem zaman testini kazanmıştır. Bu yöntem, genlerin her dalını bu dalın dişil tiplerindeki yeni mutasyon sayısının ortalamasını alarak tarihlendirmektedir.


DNA ağacındaki moleküllerin tarihinin izini sürme konusunda “Phylogeography” adlı bu yeni yaklaşımı, on yıllar boyunca kullanılan ve klasik toplum genetiği (population genetics) olarak bilinen insan toplumlarının tarihinin matematiksel
incelemesinden ayırt etmek önemlidir. Bu iki bilim dalı aynı Mendel biyolojik ilkeleri üzerine kuruludur, ama oldukça farklı amaç ve tahminleri vardır ve bu fark, birçok yanlış anlamanın ve tartışmanın kaynağıdır. Bunu açıklamanın en kolay yolu şudur: Phylogeography bireysel DNA moleküllerinin prehistoryasını inceler, toplum genetiği ise toplumların prehistoryasını. Başka bir yolla ifade
edilirse, her insan toplumu herhangi bir özel DNA molekülünün birçok versiyonunu içerir, bunların her birinin kendi tarihi ve farklı bir kökeni vardır. Her ne kadar insan prehistoryasına bu iki yaklaşım tamamen aynı şeyi temsil edemese de, onların ortak amacı insanların göçlerinin izini sürmektir. Taşıdığımız bireysel moleküllerin izini sürmek, bir bütün halinde grupların izini sürmeye çalışmaktan çok daha kolaydır.

dilaver
15-07-2008, 01:41
Y kromozomu: Adem geni

Hücre çekirdeğimizin dışında bulunan anne tarafından geçmiş mtDNA’ya benzer olarak, çekirdeğin içinde paketlenmiş olarak bulunan sadece erkek tarafından
geçen bir gen seti vardır. Erkekliği tanımlayan kromozom olan Y kromozomu. Küçük bir segment hariç, Y kromozomu, diğer kromozomların yaptıkları
rasgele DNA değişimlerinde hiçbir rol oynamamaktadır. Dolayısıyla tıpkı mtDNA gibi, Y kromozomunun yeniden karışmayan tarafı, kuşaktan kuşağa aktarılırken
bozulmadan kalıyor ve orijinal eril kökenimize kırılmayan bir çizgi halinde uzanıyor.

Y kromozomları mtDNA’lara nazaran daha kısa süreli olarak soyağaçlarını oluşturmada kullanılmıştır ve onların zaman derinliklerini tahmin etmekte daha fazla sorunla karşılaşılmıştır. Bu sorunlar çözüldüğünde, NRY metodu (Y kromozomunun izini sürmek), hem uzak hem de yakın geçmiş için zaman ve coğrafi çözünürlük konusunda daha etkili olabilir. Çünkü NRY, mtDNA’dan daha geniştir ve sonuç olarak daha fazla çeşitlilik potansiyeli taşımaktadır.

Zaten Y kromozomları, mtDNA haritasına paralel olarak bir genetik harita çıkarılmasına yardımcı olmuşlardır. Büyük coğrafi kollarda, mtDNA’nın anlattığı
hikâyeyi desteklemektedirler: Bütün modern insanlar için Afrika’daki ortak bir atayı işaret ederler ve Afrikalı olmayanlar için Asya’daki daha yakın bir atayı.

Buna ek olarak, erkeklerin davranışları bazı anahtar noktalardan kadınlarınkinden farklı olduğu için, Adem genlerinin anlattığı hikâyeye ilgi
çekici ayrıntılar eklenmektedir. Farklardan biri, erkeklerin çocuk sayısı konusunda kadınlara nazaran daha fazla çeşitlilik göstermesidir: Birkaç adam, geri kalan adamlara nazaran daha fazla çocuğa babalık etmektedir. Tersine kadınlar, sahip oldukları çocuk sayısında aynı düzeyde, “eşit” kalma eğilimi taşımaktadır. Bunun sonucu olarak eril kolların birçoğu dişil kollara nazaran daha hızlı yok olarak, birkaç dominant eril genetik kol bırakmıştır.

Bir başka fark genetik hareketliliktedir. Nitekim kadınlar genellikle kocalarının köyüne taşındığından, onların genlerinin daha hareketli oldukları düşünülmektedir. Paradoksal olarak, bir kültürel bölgede bu doğruyken, mtDNA’nın sadece bu kültürel bölgede hızlı karışım ve yayılımı sonucunu doğuruyor. Bölgeler arası seyahatlerde veya uzun mesafeli kıtalar arası
göçlerde, çocuklara bakma sorumluluğu kadınların hareketliliğini kısıtlamış olabilir. Akın eden yağmacı gruplar çoğunlukla erkek egemenliğindedir, bunun sonucunda da Y kromozomunun hareketliliği artmıştır.


Hücre çekirdeğimizin dışında bulunan anne tarafından geçmiş mtDNA’ya benzer olarak, çekirdeğin içinde paketlenmiş olarak bulunan sadece erkek tarafından
geçen bir gen seti vardır. Erkekliği tanımlayan kromozom olan Y kromozomu. Küçük bir segment hariç, Y kromozomu, diğer kromozomların yaptıkları
rasgele DNA değişimlerinde hiçbir rol oynamamaktadır. Dolayısıyla tıpkı mtDNA gibi, Y kromozomunun yeniden karışmayan tarafı, kuşaktan kuşağa aktarılırken
bozulmadan kalıyor ve orijinal eril kökenimize kırılmayan bir çizgi halinde uzanıyor.

Y kromozomları mtDNA’lara nazaran daha kısa süreli olarak soyağaçlarını oluşturmada kullanılmıştır ve onların zaman derinliklerini tahmin etmekte daha fazla sorunla karşılaşılmıştır. Bu sorunlar çözüldüğünde, NRY metodu (Y kromozomunun izini sürmek), hem uzak hem de yakın geçmiş için zaman ve coğrafi çözünürlük konusunda daha etkili olabilir. Çünkü NRY, mtDNA’dan daha geniştir ve sonuç olarak daha fazla çeşitlilik potansiyeli taşımaktadır.

Zaten Y kromozomları, mtDNA haritasına paralel olarak bir genetik harita çıkarılmasına yardımcı olmuşlardır. Büyük coğrafi kollarda, mtDNA’nın anlattığı
hikâyeyi desteklemektedirler: Bütün modern insanlar için Afrika’daki ortak bir atayı işaret ederler ve Afrikalı olmayanlar için Asya’daki daha yakın bir atayı.

Buna ek olarak, erkeklerin davranışları bazı anahtar noktalardan kadınlarınkinden farklı olduğu için, Adem genlerinin anlattığı hikâyeye ilgi
çekici ayrıntılar eklenmektedir. Farklardan biri, erkeklerin çocuk sayısı konusunda kadınlara nazaran daha fazla çeşitlilik göstermesidir: Birkaç adam, geri kalan adamlara nazaran daha fazla çocuğa babalık etmektedir. Tersine kadınlar, sahip oldukları çocuk sayısında aynı düzeyde, “eşit” kalma eğilimi taşımaktadır. Bunun sonucu olarak eril kolların birçoğu dişil kollara nazaran daha hızlı yok olarak, birkaç dominant eril genetik kol bırakmıştır.

Bir başka fark genetik hareketliliktedir. Nitekim kadınlar genellikle kocalarının köyüne taşındığından, onların genlerinin daha hareketli oldukları düşünülmektedir. Paradoksal olarak, bir kültürel bölgede bu doğruyken, mtDNA’nın sadece bu kültürel bölgede hızlı karışım ve yayılımı sonucunu doğuruyor. Bölgeler arası seyahatlerde veya uzun mesafeli kıtalar arası
göçlerde, çocuklara bakma sorumluluğu kadınların hareketliliğini kısıtlamış olabilir. Akın eden yağmacı gruplar çoğunlukla erkek egemenliğindedir, bunun sonucunda da Y kromozomunun hareketliliği artmıştır.

dilaver
15-07-2008, 01:42
160.000 – 135.000yıl önce
Buzul- buzul arası döngüleri

Son iki milyon yılda, buzullar 20’den fazla kez ilerledi ve çekildi. 140.000 yıl önce havalar bugün olduğundan 6 0C daha soğuktu. Buzların yayılması deniz seviyesini doğrudan etkiledi; bunun da ilk atalarımızın gittikleri yollar üzerinde etkisi oldu.

Dünyanın iklimi belki de dünyanın yörüngesindeki sapmalardan kaynaklanan bir dizi dramatik değişikliğe uğradı. Bunların en iyi bilineni Buzul Çağı’dır ki (Pleistosen) aslında bir dizi soğuk ve ılık fazlardan oluşmuş ve 2 milyon yıl önce başlamıştır. Bu soğuk fazlarda buzların nasıl hareket ettiğine dair en çarpıcı kanıt, kuzey enlemlerde bulunan V şeklindeki vadilerdir. Daha az belli ama aynı oranda önemli kanıtlar da kaya, balçık, rüzgârda uçuşan toz topraktır -buzun temizleyici etkisinden dolayı oluşan süprüntüler-,bunlar kuzey Amerika’da, kuzey Avrupa’da ve Uzakdoğu’da örneğin Çin’de bulunabilir. İklimsel değişikliğin dramatik etkileri sadece dünyanın görünüşüne değil, ama aynı zamanda deniz seviyesine, bitkilere ve hayvanlara da oldu. Örneğin Britanya, bir dönemde şimdiki Afrikalı hayvanları barındırırken, başka bir dönemde kutup hayvanlarını barındırıyordu.

Okyanus yataklarından alınan çeşitli çökeltiler incelendiğinde, iklim değişikliklerinin oldukça karmaşık olduğu ve soğuk “buzlu” dönemlerle daha ılık “buzul-arası” dönemlerin birbirini izlediği görülmüştür. Buzul-arası dönemlerin bazıları bugünkünden daha sıcaktı. Okyanus çökeltileri, iklimsel değişiklikleri kara temelli tortulardan daha etkili biçimde gösteriyor, çünkü okyanus yatağı çok fazla erozyona uğramamıştır. Her buzul döneminin, buzların ne kadar güneyde yayıldığına, bunun ne kadar uzun sürdüğüne ve oradaki arazi yapısını, bitki ve hayvanların hayatını ne kadar belirlediğine bağlı olarak farklı bir etkisi oldu. Her büyük buzul çağı kapsamında daha küçük çapta ılık ve soğuk dönemler bulunuyordu.

Her ne kadar kuzey ve güney enlemlerinde daha çarpıcı olsa da, bu iklimsel değişiklikler tropik bölgelerde de etkili oldu. Buz kütleleri ilerledikçe büyük miktarda suyu hapsedip yağmur veya kar olarak düşebilecek atmosfer nemini azalttılar. Buzul yerleştikçe sonuç olarak yağmur oranı düştü. Tropikal ve sub-tropikal enlemlerde artan kuraklık çöllerin yayılmasına neden oldu. Benzer olarak, buz eridikçe daha fazla su kullanılabilir hale geldi ve yağmur oranı yükseldi. Bu değişiklikler dramatik biçimde değişen kıyı çizgilerinde görülebilir. Buzullar büyük miktarda suyu hapsedince, ortalama su seviyesi düştü ve bugün deniz altında kalan toprak parçalarını açığa çıkardı. Buzul arası dönemlerde su seviyesi bugünkünden daha fazla yükseldi ve sahillerin bugünkü deniz seviyesinden daha yüksekte olmasına neden oldu.

Bu değişen iklimin prehistorya insanının yaşam alanına da büyük etkisi oldu. Geniş buz çarşafları derin vadileri kesti, kalın tortular halinde kaya, balçık ve rüzgârda uçuşan toz toprağı göz önüne serdi ve nehirlerin yollarını değiştirdi. Üstelik suyun ve yağmurun miktarındaki değişiklik, hayvan sürülerinin otlanma bölgelerini ve prehistorya insanının ihtiyaç duyduğu bitkilerin yetişmesi için elverişli toprak miktarını etkiledi. Coğrafyadaki değişiklikler göç yollarını da etkiledi. Örneğin Avrupa’da Fransa’dan İngiltere’ye yürümek mümkündü, Doğu Asya’da hem Japonya hem de Java anakaraya dahil olmuştu, Sibirya ile Alaska birbirine bağlıydı. Değişen iklimin ayrıca bitki ve hayvan hayatına derin etkileri olmuştu. Buzun ilerlemesiyle kutuplarda yaşayan türler güneye göç etmiş, havalar ılıklaşınca gene kuzeye çekilmişlerdi. Soğuk fazlarda Britanya’da yabani sıçanlar, rengeyikleri, mamutlar ve tüylü rinoceroslar yaşardı; ılık dönemlerdeyse filler, hipopotamlar ve aslanlar bulunabilirdi. Öte yandan, tropikal yağmur ormanları çok az değişiklik gösterdi, aynı hayvan ve bitki türleri orada yaşadı; her ne kadar bunların mesken tuttukları alanlar daralıp genişlese de.

Bütün çevre değişiklikleriyle iyi baş edebilmiş gibi görünen tek varlık, prehistorya insanıdır. Onu Afrika’nın otlaklarında, güneydoğu Asya’nın tropikal yağmur ormanlarında ve güney Avrupa’nın daha ılık bölgelerinde yaşarken görebiliriz; uygun koşullar oluştuğunda buralardan daha kuzey bölgelere de yayılmıştır. Bitki ve hayvan hayatındaki bu değişiklikler prehistorya topluluklarının beslenme düzenini de etkilemiştir, ama diğer türler taşınır veya yok olurken insanların hayatta kalabilmelerini sağlayan şey, farklı çevrelerle baş edebilmek için geliştirmiş oldukları teknolojidir. İklimsel değişiklikler insanın kendi gelişimi açısından da önemli olabilir. Buzul çağlarının daha sert koşulları yaşamını sürdürebilmek için insan zekâsını hayati önemde kılmış, daha geniş beyinleri, daha yaratıcı ve esnek davranışları, ileriyi hesaplama becerisini ve konuşma yoluyla daha iyi bir iletişimi sağlamıştır. Prehistorya topluluklarında böyle değişiklikler birçok kuşak boyunca sürmüştür ve taş aletlerin, yerleşim organizasyonunun, sığınak yapımının ve kıyafet kullanımının hepsi bu gelişimi yansıtmaktadır.

dilaver
15-07-2008, 01:43
Okyanus tortuları iklim değişikliklerinin izini taşıyor

Buzul Çağı’nın (Pleistosen) iklim değişikliğinin dokümantasyonunu çıkarmak karmaşık bir sorundur, çünkü buz kütlelerinin ilerleme ve gerilemesinin kaydı eksiktir. Bu, kısmen erozyonun ve Pleistosen sonrası dönemde kanıtların gömülmesinin ama daha dramatik olarak buzların her ilerleyişinin daha önceki buzların tortularının üzerilerinden geçerek bunları temizlemesinin sonucudur

Bilim insanları uzun süre sadece beş adet soğuk, buzul dönemin var olduğuna ve bu dönemlerin sadece buz kütlelerinin ilerleme ve gerilemelerinden ibaret olduğuna inanıyorlardı. Okyanus yataklarında derin delikler açılınca farklı bir tablo gösteren uzun tortu kütleleri görüldü. Derin deniz yüzeyinin tortuları genelde kesinti olmadan toplanıyor ve orada karada olduğundan daha yüksek bir çözünürlük derecesi gösteriyor.

Bu tortular ölmüş deniz yaratıklarının döküntülerinden oluşmaktadır; kalsiyum karbonat iskeletleri olan mikroskobik planktonlar (coccolithler) buzul çağlarının incelenmesinde özel bir öneme sahiptir. Böyle tortular eğer sığ tropikal denizlerde yeterince uzun süre bırakılırsa tebeşire dönüşebilir. Deniz sularının yüzeyinde yaşamış olan coccolithlerin bileşimi üzerine yapılan incelemeler, sıkışıp kalmış deniz tortularının radyometrik yolla tarihlenmesiyle bize belli zamanlardaki hava sıcaklığı dereceleri hakkında bilgi verebilir. Bu veriler daha sonra zaman içinde hava sıcaklığı derecelerindeki iniş çıkışların bir şemasını çıkarmakta kullanılır.

Tortuların tarihlenmesi dünyanın manyetik alanının ters dönmesine dair kanıtlarla karşılaştırılabilir. Nitekim bunlar da başarılı şekilde tarihlenmiş ve deniz tortularında belli olmuştur. Coccolithlerin ve vücutlarındaki
iki oksijen izotopunun oranının incelenmesi bize oldukça doğru bir şekilde deniz sıcaklığının değişimi hakkında bilgi veriyor; ayrıca herhangi belli bir zamanda hazır bulunan buz kütlesinin hacmi hakkında da; çünkü buz genellikle oksijen izotoplarından ağır olanını hapseder

dilaver
15-07-2008, 01:44
Herto Adamı

Etiyopya’da, Herto Köyü’nde bulunan üç kafatası, henüz ortaya çıkarılmış en yaşlı insanlar olarak tanımlandı. 160.000 yaşındaki bulgular,türümüzün ilk ortaya çıktığı zamanlara dair fosil kayıtlarındaki önemli bir boşluğu doldurmakta ve Homo sapiens’in kökeninin sadece Afrika’da olduğunu desteklemektedir. 160.000 yaşındaki bu insan, kendi alt türlerinin adıyla, Homo sapiens idaltu olarak adlandırıldı.

Kafataslarını bulan ekibin başındaki, Berkeley Kaliforniya Üniversitesi’nden
Tim White, Afrika kayıtlarının çok kabataslak ve üstünkörü olduğunu söyledi. Şunları ekledi: “100.000 yıl öncesinden kalan iyi insan fosilleri var ama, o zamandan 300.000 yıl öncesine kadar olan dönemden kalanlar ya çok parçalanmış, ya da kötü tarihlendirilmiş. Hatta bazen her ikisi de.”

Aksine, bu yeni bulunan kafataslarının yaşları, fosillerle birlikte bulunan
volkanik kaya kalıntıları sayesinde, kesin olarak saptanmaktadır. Kayalar
soğuduğunda, potasyum izotopunun bozunmasından argon gazı birikmeye
başlar. Bu gazın analiziyle kayaların yaşı hesaplanmaktadır, bu durum için, 154.000 yıl-160.000 yıl yaşında olduğu belirlenmiştir.

Fosillerin bulunması 1997’de, Tim White’ın fosilleşmiş bir hipopotam kafatasına rastlamasıyla başladı. Ekip birçok taş alet ve hayvan fosilleriyle birlikte 10 değişik insana ait kafatası parçalarını elden geçirdi. Bulunan çocuk kafatası 200’den fazla parçaya bölünmüştü ve yüzlerce metre uzağa dağılan parçaları toplayıp bir araya getirmek yaklaşık 2 yılı almıştı. Çocuk kafatası işaretlendi ve kırık parçalar temizlendi. Fosil parçalarının incelemesi, White’a göre, kafatasının ölümden sonra bir yere taşındığını ve muhtemelen bir atalara tapınma ritüelinin parçası olarak, ovularak temizlendiğini ortaya koymakta. Bu, ölen kimsenin kemiklerinin nesiller boyunca korunduğunun en eski kanıtı ve bu bakımdan kültürel gelişimin ileri bir seviyesini gösteriyor.

dilaver
15-07-2008, 01:45
135.000 – 115.000 yıl önce
Afrika’dan İlk Çıkış

İnsanların en sonunda primat akrabaları gibi Afrika’dan çıkmaları gerekti, ancak zamanlama ve rota her zaman olduğu gibi iklim devreleri tarafından belirlendi. Afrika dışına kuzeyde ve güneyde olmak üzere iki potansiyel rota vardı ve belirli bir zamanda hangisinin açık olacağını havanın durumu belirledi. Ve böylece açık olan kapı, kâşifleri gidecekleri yol konusunda yönlendirdi.
Kuzey mi yoksa doğu mu? Modern insanlar Afrika’yı ilk defa 120.000 yıl önce kuzeydeki açık bir kapıdan terk ettiler. Bu ilk adım facia ile sonuçlandı. İkinci mükemmel girişimleri onları atalarının da çok aşındırdığı Asya yolu boyunca güneye ve doğuya yönelmeleri konusunda teşvik etti. Avrupa 50.000 yıl öncesine kadar ihmal edildi ve oraya hiç uğranmadı.

Sahra Çölü’ne özgü emsalsiz büyük ova ve ormanları ile Afrika, iki çevresel kapısı ve geçitleri ile dünyanın geri kalanından ayrıldı. Son iki milyon yıldır bu geçitler açık ve kapalı olan birçok giriş ile çiftlik hayvanlarının dev ağılları gibi işlev görmüşlerdir. Bir kapı takımı açık olduğunda diğeri genellikle kapalı
olmuştur. Bir kapı Sahra’dan doğu Akdeniz ülkeleri ve Avrupa’ya uzanan kuzey yoluna çıkarken, diğeri Kızıl Deniz ağzı boyunca doğuya, Yemen, Umman ve Hindistan’a açılmıştır. Hangi kapının açık olduğu, buzul döngüye bağlıydı ve bu durum insanların ve diğer memelilerin Afrika’dan çıkıp kuzey boyunca Avrupa’ya mı, yoksa doğu boyunca Asya’ya mı göç edeceğini belirledi.

Bugün Afrika, Avrasya kıtasına fiziksel olarak bu geçitlerden sadece biri ile bağlıdır o da kuzey deki Sina Yarımadası’dır. Normalde Sahra ve Sina boyunca dünyanın geri kalan kısmına açılan ve potansiyel rota olan acımasız kurak çöl, sadece dünya yörüngesindeki değişimler ve kutup ekseninin eğimi bir ısınma dönemi yarattığı zamanlarda aynı bilimkurgu literatüründeki yıldız kapıları gibi açılır. Jeolojik zamanda bu kısa süreli olay her 100.000 yılda sadece bir kere güneş ısısının kutupsal erimeye neden oluşunu sıcak ve nemli küresel iklimin takip etmesi ile meydana gelir. Kısa jeolojik bahar döneminde Sahra’da, Sina’da ve Avustralya çöllerinde göller, yeşillikler ve çiçekler meydana çıkar. Ancak bu sıcak ara dönem çok kısa olduğundan kuzey Afrika mevsim kapısı göçmenler için ölümcül bir tuzak olabilir.

Gezegenimizin yüzeyinin cennet kapılarını açan kısa ve belirgin ısınışı yerbilimciler tarafından “buzul arası optimum” olarak bilinir. Bu kısa ve bereketli süreler normal olarak soğuk ve Kuru Buzul Pleistosen koşullarına ters düşmektedir. Biz modern insanların yeryüzündeki zamanımız boyunca bu anlık cennet belirtisini sadece iki kez görme şansı olmuştur. En yeni buzul arası optimum sadece 8.000 önce idi ve onun sonbahara özgü kızıllığının etkilerini hâlâ yaşıyor olmaktan dolayı şanslı sayılırız. Belki yaklaşık 2.000 yıl içerisinde Sahra çayır haline gelebilir ve güneye özgü koşullar kuzey Afrika ve doğu Akdeniz ülkeleri boyunca yayılır. İronik olarak, günümüzün küresel ısınması aslında yerküre üzerindeki zamanımızın çoğunu karakterize etmiş olan soğuk, kuru ve daha az sabit olan koşullara kaçınılmaz dönüşümüzü geçici olarak atlatmamıza yardım etmektedir.

Kendimize gerçeği göstermemiz için arkeoloji ve iklim değişimine dair bir dolu bilimsel bulguya ihtiyacımız yoktur. Bugün Sahra alanı içinde kalan Nijer’de bulunan 8.000 yıllık kalıntılarda, nesli tükenmiş olan bufaloların, fillerin, gergedanların, hipopotamların, zürafaların ve antilopların kaya çizimleri bulunmuştur. Bu renkli tarihsel geçmiş aralıklı olarak yakın zamanlara kadar
devam etmiştir. Sonraki çizimler bu dönemin yaklaşık 5.000 yıl önce ortadan kalktığını, yerini develerin devraldığını göstermektedir.

Önceki buzul arası, bilim insanları tarafından “Eemian” ya da “Ipswichian”
olarak biliniyor olup 125.000 yıl önce, yani insan familyasının doğumundan hemen sonraki dönemdir. İlk modern insanların Afrika’daki Sahra Çölü’nün güneyinden kuzey Afrika’ya ve doğu Akdeniz ülkelerine çok erken bir devirde göç ettiklerini biliyoruz, buralarda kemikleri bulundu. Aslında, modern insanın Afrika dışındaki en erken belirtilerine -90.000 ila 120.000 yıl önce-doğu Akdeniz ülkelerinde rastlanmıştır.Temel soru bu insanların orada kalıcı etki yapıp yapmadığıdır. Genetik kayıtlardan elde edilen bilgi bu etkinin olmadığı yönündedir.
http://www.evrim-teorisi.org/forum/images/misc/progress.gif

dilaver
15-07-2008, 01:46
Yeniden oluşturulmuş Havva

Afrika dışındaki Havva’nın tasvirleri doğu Akdeniz ülkelerinden kalan en iyi saklanmış kafataslarından biri ile yeniden oluşturulmuş olup; özellikleri o dönem için çok karakteristik olan güçlü yapıyı, göreceli dar bir kafatasını ve uzunlamasına bir suratı yansıtmaktadır. Bu özellikleri, komşularından -Neanderthal- farklılık göstermektedir.

İlk modern insanların doğu Akdeniz ülkeleri, komşu Avrupa bölgeleri ve batı Asya yerleşkelerine adapte olmada başarısız oldukları hipotezi ilgimizi Orta Yontmataş Çağı ile Yeni Yontmataş Çağı arasındaki farklılıklara çekmektedir. Afrika dışına doğru yönelmeyi etkin olarak engelleyen doğu Akdeniz ülkelerindeki yerleşik Neanderthal toplulukların varlığı, kuzeydoğu Afrika “sınırı” boyunca modern insanların Yeni Yontmataş Çağı’na uyumlarının gelişmesinin önündeki temel engel olmuş olabilir.

Neanderthal insanı ve Avrupa’ya modern insanın yerleşmesi

Avrupa ve batı Asya’daki Neanderthal topluluklarının kaderi gizemle örtülüdür ancak örtü yavaş yavaş aralanmaktadır. Kuzeydoğu Avrasya’nın buzul iklimlerine en az 200.000 yıl süren adaptasyon sonrası yaklaşık 30.000 - 40.000 yıl arası öncesi aniden ortadan kalkmışlar, yerlerini modern insanlar doldurmuştur.

Son on yılda genetik biliminin ortaya çıkışı soruna ışık tutmuştur. Neanderthal’lerin mevcut iskelet bulgularından elde edilen mitokondriyal DNA dizilişleri bugün bilinen tüm topluluklarınkinden büyük ölçüde farklı olup yerel Neanderthal’ler ile Avrupa’daki davetsiz modern topluluklar arasında çok az üreme olduğunu kanıtlar niteliktedir.

Modern insanın primat atalarından tam olarak nasıl ve ne zaman ayrıldığı sorusu evrimsel biyolojinin de en fazla üzerinde tartıştığı sorulardan biridir. Parça halinde fosiller ve düzensiz genetik veriler, temel anlayışı sergiler ancak kilit bir soruya cevap bulamaz: Modern ve antik insan türleri direkt temasa geçmişler midir? Karşılaşmış olmasalar da antik insan akrabalarımız istenmeyen bir yan etki getirmişlerdir: saç bitleri!

Parazitler temel verilerden bağımsız olarak evrimsel tarihi açıklamada emsalsiz işaretlerdir. Burada, kökeni modern insandan önceye dayanan modern insan saç bitinin, Pediculus humanus, iki antik soya dayandığını (1,18 milyon yıl) göstermeye çalışacağız. İki soydan birinin dünya çapında dağılımı vardır. Filogenetik ve popülasyon genetik verilerine göre sadece yeni dünyada bulunan diğer soy, son 1,18 milyon yıldır dünya çapında olan soydan izoledir. Bu iki bit arasındaki antik farklılık erken insan türleri ile eşzamanlı olup analizler iki bit soyunun nesli tükenmiş insan türleri ile birlikte farklılaşmış olduğunu göstermektedir. Eğer bu bitler 1,18 milyon yıl önce evleri ile birlikte farklılık göstermişlerse, modern insan üzerinde antik insan türünden modern insan türüne ev geçişinin açıklanması gereklidir. Bu tarz bir ev geçişi, modern ve antik insan formları arasında fiziksel irtibat gerektirir.

Ancak üremenin tüm genetik izleri sonradan Avrupa gen havuzundan silinmiştir. mtDNA’ya göre Neanderthal’lerin popülasyonlardan -genetik olarak modern popülasyonlara hız vermiş olan- ilk evrimsel ayrımı en az 300.000 yıl öncesine dayanır. Bu Afrika’daki ve Avrupa’daki fosiller ile kanıtlanmaktadır.

Genetik gibi tanımlama için kullanılan diğer bir önemli araç da, Avrupa boyunca yayılımı başlayan modern toplulukların kültürel ve teknolojik düzeyinin çalışılmasıdır. Günümüzden 40 ila 35.000 yıl öncesi arasına denk gelen bu zamana ‘Aurignacian’ ya da Yeni Yontmataş Devri denmektedir. Karışık ve dikkatlice şekillenmiş kemiğin, boynuz ve fildişi araçlarının, uzak yollar görmüş denizkabuklarının, kişisel takıların ve hem soyut hem figürsel taş sanatının açığa çıkardığı modern kültürel davranışın çiçeklenmesinin müjdecisi olmuştur. Bu Aurignacian görüntü, bariz olarak bölgenin orta yontma Taş Devri Neanderthal topluluklarında yoktu. Bu, onların, modern insan popülasyonları ile ilişki kurmasının önündeki önemli bir arkeolojik engeldir.

Ancak, Aurignacian teknolojisi kullanan modern insanların iskeletlerinin ayırt edici örneklerini tanımlayabilir miyiz? Evet: Romanya’daki Pestera cu Oase Mağarası (35.000 yıl öncesi), Lübnan’da Ksar Akil (40.000 yıl öncesi), Devon’da Kent İni (31.000 yıl öncesi), batı Fransa’da Les Rois (32.000 yıl öncesi) ve Çek Cumhuriyeti’nde Mladec (35.000 yıl öncesi). Dolayısıyla anatomik olarak tamamen modern topluluklar Aurignatian Dönem’de Avrupa’da ve Yakındoğu’da yaklaşık 30.000 yıl önce mevcuttu. Genetik çalışmalar, Avrupa boyunca günümüzden 50.000 yıl öncesine kadar modern insan (Afrika kaynaklı) dağılımını göstermektedir.

Arkeolojik araştırmalar, modern toplulukların Avrupa’ya yayılımının iki değişik rota izlediğini gösterir.

1) “Aurignac”: Batı, orta ve güneydoğu Avrupa ve yakındoğuda. Kazıyıcı, kılıç, boynuz mızrağı. ‘Klasik’ Aurignacian olarak bilinir. Ana alanlar: Bulgaristan-Bacho Kiro ve Temnata/Lübnan-Ksar Akil

2) “Akdeniz”: Avrupa’nın Akdeniz kıyısı boyunca kuzeydoğu İtalya’dan kuzey İspanya’nın Atlantik kıyısına.Proto Aurignacian olarak bilinir. Değişik teknoloji şekilleri: Mızraklar ve oklar için dikkatlice şekillendirilmiş küçük bıçaklar. Her iki rota da en erken tarımsal Neolitik toplumların habercisi olmuştur.

Peki ya etkileşim?

Olgular, modern insanın genişleyen nüfusu ile Avrupa boyunca yerli Neanderthal toplulukları ile kaçınılmaz biçimde sayısız iletişim ve etkileşimini göstermektedir. Son Neanderthal topluluklar arasında Aurignacian teknolojinin sayısız modern özellikleri görünmektedir. Etnik iletişimin varlığı, iki popülasyonun kültürel ve bilişsel kapasitelerinden bağımsız olarak bu davranışsal etkileşimi ve teknolojik transferi onaylamaktadır. Peki bu Neanderthal’lerin aynı beyin kapasitesine sahip oldukları anlamına mı geliyor? Bu hâlâ tartışmaya açıktır ve daha fazla araştırma gerektirmektedir.
Etkileşime rağmen, kuvvetle muhtemel senaryo bu iki popülasyon arasında yerleşim alanı ve kaynaklar için bir yarışma olduğudur. Yeni teknolojiyi kullanışımız ve örgütsel yeteneklerimiz -karışık dilbilimsel ve sembolik iletişim sayesinde- özellikle iklim ani dalgalanmalar yaşıyor iken avantajlı olmuştur.
http://www.evrim-teorisi.org/forum/images/misc/progress.gif

dilaver
15-07-2008, 01:47
İlk göçmen gruplarının yok oluşu
115.000 – 90.000 yıl önce

İlk zamanlarda, Afrika kökenlilik yanlısı bilimsel kamp tarafından doğu Akdeniz’deki ilk modern insanlar için onaylanan görüş, modern insanların kuzeye ilk göçü sırasında, burada Avrupalılar’ı ve Asyalılar’ın çoğunun gelişimine kaynaklık edecek bir çekirdeğin oluştuğuydu. Ancak bu iddiada temel eksiklikler vardı. Modern insanın doğu Akdeniz’deki ilk izleri maalesef 90.000 yıl önce yok olmuştu. İklimsel kayıtlardan görebildiğimize göre, bundan 90.000 yıl önce bütün doğu Akdeniz’i çöle çeviren kısa ama etkili bir küresel donma ve kuraklık yaşanmıştı. Donmanın ardından, çölleşmiş doğu Akdeniz ülkeleri kısa bir zaman sonra bölgenin diğer sakinleri, muhtemelen buzullar tarafından Akdeniz’e doğru göçe zorlanan ilk kuzenlerimiz olan Neanderthaller’ce işgal edilmiştir. Bir 45.000 yıl geçene dek doğu Akdeniz ve Avrupa’da modern insanın varlığına ilişkin, daha fazla fiziksel kanıt yoktur. Ta ki, Cro-Magnon insanları 45.000 ila 50.000 yıl önce ortaya çıkana (Aurignasyan taş tekniğinin varlığı bunu gösteriyor) ve kuzeydeki yaşam hakları için Neanderthaller’le başa çıkana kadar.

Bundan dolayı çoğu uzman, Afrika kökenli ilk modern insanların, kuzey Afrika ve doğu Akdeniz’i çöle çeviren kuru buzul koşulları sırasında, doğu Akdeniz’de ölmüş olmaları gerektiğini kabul etmektedir. Sahra’nın kuzey geçidinde sıkışmışlardır, geri dönüş için yol yoktur ve sığınak rolü oynayabilecek uygun yerleşim alanları çok azdır. Doğu Akdeniz ülkelerindeki ilk modern insanların ortadan kayboluşu ile çok sonraları Avrupa’nın Cro-Mangon’lar tarafından istilası arasındaki 50.000 yıllık boşluk, kuzey Afrika göçünün Avrupalılar’ın ortaya çıkışına kaynaklık ettiği yönündeki en geçerli teori hakkında ciddi şüphelerin doğmasına neden olmuştur. Şimdi neden olduğunu göreceğiz.

Birçok Avrupalı arkeoloji ve antropoloji uzmanı, neden Avrupalılar’ın
ayrı olarak bir kuzey Afrika göçünden kök aldığını ileri sürüyor? Kuzey toplu göçünün dayanak olduğu Avrupa merkezli kültürel bir gündemin varlığının ayırdında olmak, bunu anlamamıza yardımcı olacaktır.

En önemlisi ise, Avrupa içlerine en fazla 50.000 yıl önce göç etmiş olan Cro-Magnon’ların, en gelişmiş zihinsel yetenekler bakımından, modern insanlar olarak türümüzün başlangıcını oluşturduğu yönündeki 20. yüzyılın Avrupalı inancıdır. Bu Tanrının insan suretinde görünüşü, sanatın, üretim becerilerinin ve kültürün sıra dışı zenginleşmesi, arkeologlar tarafından büyük bir ciddiyetle “Avrupa Geç Paleolitik Çağı” olarak adlandırılır.
Birçoğuna göre bu dönem, duygulu ve bilinçli bir tür olarak insanın yaklaşmakta olan çağının müjdecisi olan bir yaratıcılık patlamasıdır. Chauvet ve Lascaux’daki görkemli mağara çizimleri ve tüm Avrupa’da bulunan incelikle yontulmuş Venüs figürleri bu kültüre dayanmaktadır.

İddia şöyle devam eder: Kesin olarak Afrika’dan geldiysek ve eski çağların soyut düşünceyi anımsatan bu artistik devrimi doğu Akdeniz’den geldiyse, bu göç sadece Mısır’dan başlayan kısa bir yürüyüştür. Dolayısıyla, “biz batılılar” (bu görüşün destekçilerinin tümü köken olarak Avrupalı’dır) Kuzey Afrika’dan gelmiş olmalıyız. Öyleyse, bir çok uzmana göre,kuzey rotası Afrika kökenli göçlerin teorik olarak başlangıç noktasıdır. Daha sonra haritada, Avrupalılar’ın ilk “tümüyle modern insanlar” olmasının mantıksal olarak neden imkânsız olduğunu ve Afrikalılar’ın ana kıtalarını terk etmeden çok önceleri, nasıl tümüyle modern, şarkı söyleyen, dans eden, resim yapan insanlar olduğunu göreceğiz.

Ancak izaha muhtaç başka gerçek sorunlar da vardır: Örneğin, Avrupalıların
Sahra-altı bölgesindeki atalarının, o zamanlarda kuzey Afrika üzerinden nasıl geçebildikleri. İlk olarak, yol üstündeki Sahra Çölü’nün son 100.000 yılın çoğu boyunca koruduğu geçilmezliği düşünüldüğünde, Avrupa’nın kuzey Afrikalılarca istilası, sadece, 100.000 yıldan daha önce yaşanmış bir iklimsel yumuşama sonucunda kuzey Afrika’daki yeşil kalmış sığınaklardan –örneğin Nil Deltası- doğmuş olabilir. Avrupalılar doğrudan Sahra-altı Afrika bölgesinden gelmiş olamazlar, eğer ki kütükler üzerinde bütün Nil boyunca seyahat etmemişlerse. Ki bunu genetik tarih de yalanlamaktadır

dilaver
15-07-2008, 01:48
Dünyanın İlk İstiridye Lokantası
90.000 - 85.000 yıl önce

İnsan evriminde anahtar sorulardan biri atalarımızın nasıl ve ne zaman Afrika’nın dışına göç ettikleridir. Eski bir mercan kayalığın içine hapsolmuş taş aletlerin keşfi bu soruya bir cevap sunuyor.

Eritre’deki keşfi gerçekleştiren uluslararası ekibin başındaki Kanadalı jeolog Bob Walter, “Bunu dünyanın ilk istiridye lokantası olarak adlandırın” diyor. Zula Körfezi’nin Kızıl Deniz kıyısında, ekiptekiler geçen Ocak’ta bir sabah uyandılar ve şimdi deniz seviyesinden altı metre yüksekte olan 125.000 yaşında ihtiyar bir mercan kayalığının yüzeyinde kamp yaptıklarını fark etti.

Mercan kayalığına, deniztarağı, istiridye ve yengeç fosilleri ve daha önemli olarak iki tür taş alet hapsolmuştu. Bu, deniz çevresine yakın yaşayan insanlara dair en erken tarihli kanıttı -belki de atalarımızın deniz ürünü yemeyi öğrendikleri yer. Walter’ın iddiasına göre her kim bu aletleri kullanıyorsa, bunları yengeç, deniztarağı ve istiridye avlamak için kullanıyordu.

Neden bu mercan kayalığı deniz seviyesinin üstünde?

Yerin üstünde bir mercan kayalığı görmek tuhaf gelebilir, ama bunun sebebi basittir: Eskiden olmuş bir iklim değişikliği. Buzul çağları boyunca, dünyanın okyanuslarının büyük bölümü kutuplardaki buz kütlelerine hapsolmuş, bu da deniz seviyelerinin dramatik bir biçimde düşmesine neden olmuştu. Son iki Buzul Çağı boyunca, kabaca 150.000 - 20.000 yıl önce, deniz seviyeleri şimdiki seviyenin 130 m kadar altına düştü. Bununla birlikte, şu anda yaşamakta olduğumuz gibi buzul arası devirlerde, deniz seviyeleri tekrar yükseldi. Walter, Eritre’deki alet bakımından zengin mercan kayalığının 125.000 yıl önce, deniz seviyesinin bugün olduğundan 6 m daha yukarda olduğu bir zamanda oluştuğuna inanıyor.

Ekip iki ana taş alet türü buldu: Volkanik camdan yapılma Acheulean el baltaları ve obsidiyen aletler. Bu kafa karıştırıcı bir durum, çünkü Acheulean el baltaları bulmak için tarih çok geç, bu endüstrinin 300.000 200.000 yıl arasında sona erdiği sanılıyordu. Obsidiyen aletler ise daha geç dönemlere ait olarak görülüyordu ve Paleolitik bir dönemden ziyade tarımın başlangıcıyla birlikte MÖ 7.000-6.000 civarında kullanıldıkları düşünülüyordu. Bu ikisinin birlikte bulunması daha da şaşırtıcıydı

dilaver
15-07-2008, 01:48
Gözyaşı Kapısı

Afrika’dan çıkan güney yolu -çıkışların ikincisi ve yegâne başarılı olanı- Kızıl
Deniz’in güney ucunda birçok kayalığından dolayı Gözyaşı Kapısı (Bab-ül Mendeb) olarak bilinen 25 km genişliğinde ve 137 m derinliğinde bir kıstaktır.

Dünyanın buzlandığı sırada elverişli olan Kızıl Deniz üzerinden bir güney yolu 85.000 yıl önce Afrika’dan göçe dair artan kanıtları açığa vuruyor.

Geçit buzul devirler sırasında daha dardı; sığ alanlarda ve geçidin kuzey ucundaki Hanish al Kubra’nın kayalık adalarında, kolayca adadan adaya atlamayı mümkün kılıyordu. Grönland buzul kütlesindeki ölçümler son 100.000 yıl içinde ikinci en soğuk dönemin 60.000 - 70.000 yıl öncesi arasında olduğunu gösteriyor. En soğuk anında, 65.000 yıl önce, bu buzlanma deniz seviyelerini bugünkü seviyesinin 80 metre aşağısına taşıdı. Bu, şüphesiz harekete geçmek için bir uyarıydı.

Belki de Kızıl Deniz’in batı kıyısında azalan besin kaynakları, Aden Körfezi’ndeki çekici sahiller ve sığınmak için elverişli serin nemli Yemen yaylaları atalarımızı önemli adımlarını atmak için kamçılayan unsurlar olmuşlardı.

Tek mitokondriyal DNA kolu – Afrika kökenli

Bütün Afrikalı olmayanlar, Afrikalı L3 dalına bağlı olup ondan türemişlerdir. Aşağıdaki diyagramda noktalı çizgi Gözyaşı Kapısı’nda Afrika dışı L3 Havva’sını işaret ediyor.

Yandaki şekiller 80.000 yıldan daha yaşlı olan 15 yaşayan Afrikalı maternel mitokondriyal kolu temsil ediyor. Bu 15 koldan sadece bir tanesi birçok kuşak için Afrika dışı Havva kolu veya dünyanın geri kalanı için ortak ata anne kolu haline gelecekti. Bu rasgele seleksiyon ve yok oluş süreci, genetik kayma (genetic drift) olarak adlandırılmıştır; çünkü orijinal kol karışımı bir tek genetik tipe doğru kaymıştır.

16. kuşaktan itibaren geriye dönünce görülüyor ki, hepsinin atası aynı annedir.

dilaver
15-07-2008, 01:50
Kıyı Kenarındaki Yaşam Biçimi
85.000 - 75.000 yıl önce

Dünya’da geçirdikleri ilk 2 milyon yılın büyük bölümünde, insanlar avcı-toplayıcılar olarak savanları dolaşıyorlardı. Güney Afrika-Kalahari’de olduğu gibi, grup olarak avlanma sayesinde, kökler, meyveler ve yapraklarla beslenen hayvanların besin açısından büyük değerini keşfettiler. 130-190.000 yıl öncesinin büyük Buzul Çağı savanların alanını daraltmaya başlayınca, içlerinden birinin aklına kabuklu deniz hayvanları ve sahilden başka deniz ürünleri yemek geldi. Kıyı yerleşimleri muhtemelen daha da önce başlamıştı ama, artık kıyılar su altında kaldığına göre, bunu hiçbir zaman bilemeyiz. Protein açısından zengin böyle bir beslenme düzeni, beyin için faydalı ve karadaki avlara nazaran elde edilmesi daha kolaydır. Kaldı ki savanlar buzul çağında kurudukları zaman bile, deniz ürünlerinin varlıklarını sürdürmek gibi bir avantajları vardı.

Kabuk artıklarının karakteristik yığınları günümüze kadar kaldığı için, böyle bir kıyı yerleşiminin kanıtlarına rastlamak oldukça kolaydır.Tek sorun, insanların ne kadar uzun süredir kıyılarda yerleşmekte olduklarını bulmaktır. Kabuk artıkları genellikle denizin kabarma çizgisinin tam üstünde bulunur ama, geçmiş 200.000 yılın çoğunda deniz seviyesi bugünkü sahillere nazaran metrelerce aşağıdaydı. Dolayısıyla -örneğin 125.000 yıl önceki dönem gibi- ara buzul dönemlerinde deniz seviyelerinin yüksek olduğu sıralarda yayılan kabuklar hariç birçoğunun kaybolduğunu düşünebiliriz.

Neanderthaller İspanya ve İtalya’daki sahilleri 60.000 yıl önce doldurdular, onların bu alışkanlıklarını Afrika’dan getirmiş olmaları mümkündür. Bununla birlikte, yakın geçmişe kadar, Afrika’daki kıyı yerleşimine dair en eski tarihli kanıt Güney Afrika’daki Klasies Nehri’nden gelmektedir ve 100 - 115 bin yıl öncesine tarihlendirilmiştir. Gene de 2000 yılında, Gözyaşı Kapısı’nın tam kuzeyinde Kızıl Deniz’in batı kıyısında Eritre’deki Abdur’da daha erken tarihli bir kıyı yerleşiminin izine rastlanmıştır. Eemian ara buzul döneminin doruk noktasına, 125.000 yıl öncesine tarihlenmiş olan bu sahil yerleşmesi, büyük memeli hayvanların parçalanmış kalıntılarını da barındırdığı için karışık bir beslenme düzenine işaret ediyor. Volkanik bir cam türü olan obsidiyenden yapılmış bıçak ağızları, modern insanlar tarafından kullanılmış gibidir.

Kızıl Deniz’deki bu yerleşim yerinin önemi iki kat fazladır: Bir kıyı yerleşimi hakkında en erken tarihli kanıtı sunmaktadır ve Afrika’dan güney çıkış yoluna çok yakındır. Her iki durum da taa Avustralya’ya uzanabilecek çekici bir modeli yansıtır. Kıyı yerleşimleri kalabalıklaşıp kıyı alanına sığamayacak hale gelince, bir sonraki keşfedilmemiş kıyıya yerleştikleri, böyle böyle devam ettikleri gibi ilgi çekici bir hikâyeye ulaşıyoruz. Böyle hızlı bir ilerlemeyle, Kızıl Deniz’den yola çıkan öncü gruplar Hint Okyanusu’nu çevreleyen kıyıları izlemiş ve 10.000 yıl içinde doğrudan Endonezya’ya ulaşmış olmalıdır. Zamanın düşük deniz seviyeleri Aden’den Java Burnu’na kara yürüyüşüne izin vermiş görünmektedir. Sonra da insan yerleşiminin en eski izlerinden kabuk artıklarının bulunduğu Avustralya’ya doğru adadan adaya atlamış olmalıdırlar.

Avustralya’nın erken kolonizasyonuna dair bu modelin gerçek olması kuvvetle muhtemeldir, ama tarihler sadece arkeolojik kanıtlarınkiyle değil, bütün diğer Avrasya yayılmalarının genetik soyağacındaki moleküler saat ile de uyumlu olmalıdır. Eğer bu sahili takip etme teziyle, hem Avustralya’ya hem de dünyanın geri kalanına yayılan tek bir Afrika dışına göç modeli kuracaksak, Hindistan’a, Güneydoğu Asya’ya doğru yayılmanın ve Yeni Gine’ye doğru paralel hareketin sırası ve tarihleri konusunda güçlü tahminler yaparak işe başlamalıyız. Bu tahminler teorinin sınavı olmalıdır.

dilaver
15-07-2008, 01:51
Toba Dağı volkanik süper-patlaması
74.000 yıl önce

Kuzey Sumatra’daki Toba Gölü dünyanın en geniş aktif volkanik çöküntüsüdür. Toba Gölü’nde (100 x 30 km) 74.000 yıl önce meydana gelen volkanik patlama, son 2 milyon yılın en büyük patlaması olarak bilinmektedir. Bu mega-patlama oldukça uzun süren bir nükleer kışa neden olmuş ve bu patlamadan yayılan küller kuzeybatıya doğru oldukça geniş bir alana yayılıp, 1,5 metre kalınlığında bir örtü halinde Hindistan’ı, Pakistan’ı ve körfez bölgesini kaplamıştı. Toba’dan yayılan küller Grönland’daki buz tabakalarında ve Hint Okyanusu’nda sualtı çukurlarında bulundu ve patlamanın kesin tarihinin belirlenmesini sağladı. Toba patlaması, insanın tarihinde, son Buzul Çağı’ndan önce meydana gelen en dramatik, doğru şekilde tarihlenmiş ve kesin olaydır.

Bazı araştırmacılar, onu izleyen “nükleer kış” nedeniyle Toba olayını, dünya çapındaki toplu ölümlerin sebebi olarak görürler. Konuyu ele alırken bu olguyu da hesaba katmak gerekir. Toba külleri Sumatra’dan kuzeybatıya Hint Okyanusu üzerinden geçerek yayıldığına göre, Hindistan, kül yağmurundan en fazla etkilenen ve bu nedenle insanların kitleler halinde yaşamını yitirdiği bir bölge oldu. Bu olay iki ana genetik dal olan M ve N’nin maternal genetik alt gruplarından Hindistanlılar’a has olanların çoğunun neden Asya’nın diğer bölgelerinde bulunmadığını ve bu grupların yeniden yayılma tarihlerinin paradoksal olarak Hindistan’da neden doğu Asya ve Avustral-asya’ya nazaran daha geç olduğunu açıklayabilir.

Toba patlamasından önce Asya’ya gelenler

Eğer atalarımız Afrika’yı 85.000 yıl önce terk ettilerse, onların soyundan
gelenlerin Toba patlamasından 10.000 yıl daha önce Asya’da yaşamış olması gerekir ve Hint Okyanusu’nun kıyılarında yaşayanlar, insanlık tarihinin en büyük volkanik kül yağmurunun doğrudan hedefi olmuşlardır. Toba patlaması bu nedenle oldukça önemli bir tarih belirleyicidir; çünkü küller çok geniş bir alanı kaplamıştır ve bozulmamış bir katman halinde bulundukları her yerde kesin olarak tanımlanıp tarihlenebilir.

Afrika’dan Avustralya’ya uzanan yolun üçte ikisi kadar bir mesafede Malezya Yarımadası’nda Perak Bölgesi’ndeki Lenggong Vadisi’nde bulunmuş olan Paleolitik Çağ’a ait Kota Tampan kültürünün yeniden değerlendirilmesi
sonucunda, Avustralya’ya insanların yerleşmesinin zamanı konusunda önceden belirlenmiş tarihler tekrar onaylandı. Bu kültürün ilk tanımlanışı, ilginç, geniş ve biraz kaba saba taş aletlerin bulunmasıyla oldu. Bu aletlerin sadece tek tarafı şekillendirilmişti ve arkeologlar 1960’larda bunların daha erken insan türlerinin elinden çıkmış olabileceğini düşünmüşlerdi. Bununla birlikte, aletlerin etrafını çevreleyen jeolojik katmanlar yeniden incelendiğinde, bunların daha yakın bir zamanda yapılmış oldukları anlaşıldı. 1975’te Sarawak Müzesi’nin küratörü Tom Harrison, aletlerin Sumatra’daki Toba Yanardağı’nın patlamasıyla ilintili olabileceğini iddia ettiğinde, bunlara olan ilgi daha da arttı.

Arkeolojik kanıtlar

Malezyalı arkeolog Zuraina Majid, Perak bölgesinde Penang yakınında ağaçlı bir vadide bu kültürün kalıntılarını buldu. Kota Tampan kültürü diye bilinen, kesintisiz bir Paleolitik gelenek orada on binlerce yıl öncesine uzanıyor. Bir kazı bölgesinde, bu geleneğe ait aletler Toba volkanik küllerinin içine gömülmüş bir halde bulunmaktadır. Bu aletlerin modern insanla ilişkili oldukları kesinleştiği takdirde, bu, modern insanın güneydoğu Asya’ya 74.000 yıldan daha önce, Toba patlamasından erken bir tarihte yerleşmiş oldukları anlamına gelir. Bu durumda, 85.000 yıl önceki toplu göç tezi daha olası bir hale gelir. Avustralya’da 65.000 yıl önceki insan yerleşimine dair genetik ve diğer kanıtlar bu senaryoya uygun düşmektedir.

Toba patlaması, özellikle geniş Hindistan bölgesini kalın bir kül katmanıyla kapladı. Hindistan’a ilk yerleşenlerin felaketlerin bu en büyüğünden sonra hayatta kalmayı nasıl başardıklarını anlamak kolay değil. Doğu ile batı Asya arasındaki bölgede geniş bir kuşak boyunca toplu ölümlerin olduğunu tahmin edebiliriz. Böylesine geniş bir doğu-batı bölünmesi veya “yarık” genetik kayıtlarda da açıkça görülmektedir.

Genetik izler

Toplu göç için böylesine erken bir tarih, genetik verilerle nasıl bu kadar uyumlu olabilir? Bu, meselenin belki de en tartışmalı ve heyecan uyandırıcı kısmı. Bu sorunun kısa yanıtı, genetik tarihlerin ve soyağacının bu erken toplu göçle oldukça uyumlu olduğudur. Bu, ayrıca Avrupalılar’ın kökleriyle ilgili soruyu, Avrupa’da insan yerleşiminin Avustralyalılar ve Asyalılar’la aynı maternal atalardan doğup, neden sadece 50.000 yıl önce başladığını da açıklıyor.

Güneydeki bu tek ve başarıyla sonuçlanmış toplu göçün ilk yerleşim yeri olan güney Asya bölgesi, bu yayılmayla taşınan genetik köklerin, sadece Hint Okyanusu civarındaki Aborjin diye adlandırılan halklarda değil, modern halkların çoğu arasında da var olduğunu gösteriyor. Bu köklerin arasında, geniş Avrasya Kıtası’nın içlerine doğru yapılan sonraki öncü yürüyüşlerin en batıda olanlarının genetik üslerini tespit edebiliyoruz. Bu yürüyüşler bir moladan sonra, Avrupa, Kafkasya ve orta Asya’ya doğru devam etti. Öyle görünüyor ki, okyanus kıyısı halkının öncüleri, Afrika kökenli grubun orijinal genetik çeşitliliğini şaşırtıcı bir oranda korumuş ve Hint Okyanusu kıyılarında çok daha hızlı hareket etmiştir. O kadar hızlı ki, daha ilk kuzenleri Avrupa’ya varmadan çok önce, Endonezya etrafından ve Okyanusya’nın yakın kesimlerinin içerisinden yol alarak Avustralya’ya yerleşmişlerdir.

Büyük göçün ve onun ardından güneydoğu Asya’ya gelişin, 74.000 yıl önceki Toba Yanardağı patlamasıyla kronolojik açıdan tam olarak örtüşmesi kritik önemdedir. Çünkü birincisi, Toba olayı, Paleolitik Çağ’ın en doğru ve kesin bir biçimde tarihlenmiş olaylarından biridir ve bu olayın neden olduğu kül yağmurları bütün güney Asya için bir tarih ölçer niteliği taşır. İkinci olarak, Toba’dan yayılan kül yağmurunun ve ardından kaçınılmaz olarak gelen “nükleer kışın” etkileri bu küllerin güzergâhında bulunan bütün canlılar için bir felaket oldu. Daha uzaktaki bölgelerde de durum kötüydü. Malezya Yarımadası’nda Toba külleriyle beraber modern insanlarca yapıldığı düşünülen aletlerin bulunması, kıyılara ilk yerleşenlerin Uzakdoğu’ya patlamadan önce yerleşmiş olabileceklerini gösteriyor. Bu nirengi noktasının diğer kanıtlarla örtüşmesi, senaryoyu destekliyor.

Diğer ipuçları

Güney Çin’deki Liujiang kafatasına dair yeni saptanan tarihler, Avustralya’da lüminesans yöntemiyle saptanan tarihler, Avustralya’ya geçişi mümkün kılan en alçak deniz seviyesinin 65.000 yıl öncesine tarihlenmesi, L3 grubunun yayılımının genetik tarihlerinin 83.000 yıl olarak saptanması ve Kızıl Deniz’in önemli derecede tuzlanmasının 80.000 yıl önce gerçekleştiğinin belirlenmesi. Asya’daki ilk modern insanlara dair en iyi kanıtlar, gerçek fosillerden ve onların yaşları saptanmış ortamlarından gelmektedir. Böyle bir çalışma Flores’deki Liang Bua kazı alanında yürütülmektedir.

Bu nedenle, eğer gerçekten Toba Hindistan’a insan yerleşiminin başlamasından sonra patladıysa, Hindistan Yarımadası’nda, özellikle doğu tarafından batıdan daha fazla geçekleşen toplu ölümlerin yaşandığını tahmin edebiliriz. Bu şüphesiz Hindistan’ın genetik haritasındaki çelişkiye
getirilen yorumlardan sadece bir tanesidir. Bu haritada, kıyılarda yaşayanların genetik izlerine rastlanabilir ama M ve R’nin Hindistan’a has alt grupları sadece bu kıta parçasında, özellikle güneydoğu kabilelerinde görülmektedir. Bu, büyük bir felaketten kurtuluşun sonucu olarak beklenebilecek bir durumdur. Bu yerel genetik dalların en eskisi 73.000 yıl öncesine tarihlenmiştir.

Sonraki bölümlerde, bu öncü grupların kuzey ve doğu Asya’ya geldikten sonra ne yaptıklarını ve buralara nasıl geldiklerini göreceğiz. Tüm bu tahminler içinde en kesin olan, güney Asyalılar’ın (özellikle Hindistan, Pakistan ve Basra Körfezi), Afrikalı olmayanların dağılımının kaynağı olarak merkezi bir rol oynamış olduğudur. Genetik soyağacıyla ilgili olarak, Afrikalı olmayan en erken genetik kollar güney ve güneydoğu Asya’da bulunmaktadır. Modern insanların doğu ve orta Asya’ya ilk yerleşiminin tarihleri kesin olmayan kafatası tarih ölçümleri ve daha geç tarihli bir Mongoloid yerleşiminin belirgin kanıtları nedeniyle kesin olarak belirlenememiştir; ama Liujiang kafatasının 68.000 yıl öncesi olarak saptanan yeniden tarihlenmesi doğruysa, ilk kolonilerin güney Çin’e yerleşimi, güneydoğu Asya’yla aynı dönemde gerçekleşmiş olmalıdır. Eğer modern insanlar güneydoğu Asya’ya Toba patlamasından önce yerleşmişlerse, Hindistan ile Uzakdoğu arasındaki kesin genetik kopukluk, Hindistan’ı 74.000 yıl önce kaplamış olan kül tabakasıyla açıklanabilir.
http://www.evrim-teorisi.org/forum/images/misc/progress.gif

dilaver
15-07-2008, 01:53
Toba patlaması ve genetik kanıtlar

Belki de tarihlemedeki kesinlikten daha önemli olarak, Malezya’daki taş aletlerle Toba volkanik küllerinin arasındaki ilişkinin, ilk Hintli ve Pakistanlılar’ın, şimdiye dek insanlığın başına gelmiş en büyük felaketin yolu üstünde olduğunu göstermesidir. Bu felaket, son iki milyar yıl içindeki en büyük patlama olan Toba Yanardağı patlamasıydı. Rüzgârla birlikte, yanardağdan yayılan kül yığınları kuzeybatıya yayıldı ve bütün bir Hindistan kıtaaltı bölgesini kapladı. Bugün bile, bölgede 1 m kalınlığında bir kül tabakası görülmekte ve Hindistan’da iki bölgede, Orta ve Geç Paleolitik aletlerle birlikte bulunmaktadır. Bu aletlerle küller arasındaki bağla ilgili önemli bir tahmin, genetik açıdan geniş ve derin bir yarığın doğuyu batıdan ayırdığı, sonuç olarak Hindistan’ın her iki taraftan da yeniden yerleşime uğradığıdır. Böyle bir yarık Asya’nın genetik haritasında görülmektedir.

Perak’a çok yakın olduğu halde, Toba Yanardağı’nın kül yığınları Malay Yarımadası’nı sadece sıyırıp geçti. Kota Tampan yerleşimindeki insanlar şanssızdılar, yarımadanın geri kalanındaki insanlarsa kaçmayı başarmışlardı. Bazı araştırmacılar, kafatası biçim ve ölçülerine dayanarak, hâlâ kuzey Malezya’nın sık yağmur ormanlarının aynı bölgesinde yaşayan Semang Aborjin “negrito” (orta ve güney Afrika ile bazı Pasifik Adaları’nda bulunan cüce yapılı zenci topluluk) avcı-toplayıcılarının, Perak adamının soyundan geldiğini iddia etmektedir. Zerania Majid’in ileri sürdüğü gibi, Kota Tampan kültürünün sürekliliği, Toba külleri içindeki 74.000 yıllık aletlerle bağ kuracak bir halka olmaktadır.

Kıyılarda ilk yaşayan insanların soyundan gelmiş olabilecekleri düşünülen
topluluklar içinde en iyi bilinenler Semanglar’dır. Çinhindi ve Malay Yarımadası’nda, kıyı insanlarının soyundan gelmiş olmaları muhtemel
bir başka grup ise, fiziksel olarak Semang ve Mongoloid arası bir görünümü olan, Aborjin Malaylar olarak adlandırılan topluluktur.

Doğu Asya’nın genetik yapısına dair yürütülmekte olan daha geniş bir çalışmanın parçası olarak, Malay Yarımadası’ndaki Aborjin grupların genetik incelemesi yapılmaktadır.

MtDNA sonuçları oldukça heyecan uyandırıcıydı: Semang grubun dörtte üçü (mesela negrito grupları) başka yerlerle karışmışlığı oldukça düşük bir düzeyde olan kendilerine has M ve N dallarına sahiptirler; bu da atalarının ilk kıyı insanlarıyla beraber geldikleri teziyle uyumludur.Onların kendilerine özgü genetik dalları M ve N köklerine doğru uzanıyor (L3’ün Afrika dışındaki ilk kızları). M dalları güneydoğu veya doğu Asya’da (veya başka yerde)kimseninkiyle ortak değil. Her ne kadar yakın geçmişteki nüfus azalmasından dolayı çeşitliliği azalsa da, yaşlarının 60.000 civarında olduğunu tespit etmek için yeterince çeşitlilik muhafaza etmişlerdir. Onların N dalındaki diğer kendine has grupları, N’nin genetik kızı R’den gelmektedir. Diğer Avrasyalı topluluklarla belli bir bağlantıdan yoksun oluşları, onların bu kadar uzun süre önce buraya geldikten sonra Malay Yarımadası’nda genetik açıdan izole yaşadıkları savıyla uyumludur.

Avustralya’nın 60.000 yıldan daha önce kolonize edilmesi aynı göçün parçasıydı

Bazı araştırmacılar, Avustralyalı Aborjinler’in Afrika’dan, Avrupalılar’ın, Asyalılar’ın ve Amerika yerlilerinin doğuşuna neden olan göçten daha önce gerçekleşmiş bir başka göçü temsil ettiklerini düşünmektedir. Oysa genetik haritamız bize başka bir şey söylüyor. Avustralya’nın maternal klanları üzerine yapılan bazı incelemeler, tümünün, iki kendine has Afrikalı olmayan üstklanımıza yani M ve N’ye ait olduklarını gösterdi. Öte yandan Y kromozomları üzerine yapılan geniş incelemeler, erkek Avustralyalı dalların hepsinin tıpkı diğer Afrikalı olmayanlar gibi aynı Afrika kökenli Adem klanına (M168) ait olduğunu gösteriyor. Aynı model sadece aynı atadan geçmiş olmayan genetik işaretlerde de görülmektedir. Bir başka deyişle, bu genetik kanıtların birleşimi, Avustralyalılar’ın kökeninin, ayrıca bu tek Afrika kökenli göçe dayandığını açıkça gösteriyor. Arkeolojik tarihlemelerle birlikte bu yaklaşımın mantığı, modern insanların Malay Yarımadası’na gelişlerini 74.000 yıldan daha önceye ve Avustralya’ya gelişlerini ise yaklaşık 65.000 yıl önceye yerleştiriyor. Bu aynı zamanda, kıyı civarındaki yerleşimlerden hareketle tahmin edilen Afrika’dan çıkış tarihiyle de uyumludur.

Afrika’dan Hint Okyanusu’na doğru yürüyüşün zamanı konusunda tahminlerimiz, kıyı insanlarının kıyı boyunca Perak’a gitmelerinin sadece 10.000 yıl sürdüğü ve Avustralya’ya yerleşmek için aşağı yukarı bir 10.000 yıl daha geçirdikleri yönündedir.Bu, Afrika’nın yaklaşık 85.000 yıl önce terk edilmesi ve Avustralya’ya 65.000 yıl önce varılması arasında geçen süredir. Bu tarihlerin ilki, Afrikalı L3 kümesinin yayılması için moleküler saat kullanarak tahmin edilen tarihle uyumludur.

Hindistan’daki genetik yarık neden oluştu?

Hindistan’ın kuzeyi ve doğusunda ani bir genetik değişim görülmektedir. Bu değişiklikler fiziki görünümlerde bile belli olmaktadır. Nepal, Burma ve doğu Hindistan’da ilk Mongoloid doğu Asyalı yüzlerle karşılaşmaktayız.Bu topluluklar genellikle doğu Asya dillerini konuşmaktadırlar ve Hint-Avrupalı veya Dravidyan dillerini konuşan komşularıyla güçlü bir tezat oluşturmaktadırlar. Burma’ya ve Himalayalar’ın kuzey kıyısında Tibet’e gittiğimizde, doğu Asyalı görünümüne ve etnolinguistik geleneklerine doğru geçiş tamamlanmış oluyor, tıpkı M ve N’nin mitokondriyal alt gruplarının hızlı ve tam değişiminin tamamlanmış olduğu gibi. Örneğin Tibet’te M gruplarının N gruplarına oranı 1/5’ten 3/1’e doğru değişiyor. Bu grupların alt gruplarıysa Hindistan’ınkilerle tatmin edici bir düzeyde örtüşmüyor. Aksine, Tibet’te tipik doğu ve güneydoğu Asyalı M ve N alt grupları yüzde 70 oranında görülüyor, kalanı da henüz sınıflandırılmamış yerel kaynaklı M tiplerinden oluşuyor. O halde, Hindistan kıta altının kuzeydoğu kısmı, doğu- batı sınırının en açık ve en derin olduğu yerdir. Bu sınır muhtemelen 74.000 yıl önce Toba Yanardağı’nın kül bulutuyla Hindistan boyunca meydana gelen derin genetik yarığı yansıtıyor.

Hindistan Yarımadası’nın güneyine doğru, genel fiziki görünüm genellikle daha koyu tenli, kıvırcık saçlı, yuvarlak gözlü Dravidyan tipine doğru değişiyor. Kafatası şeklinin karşılaştırılması sonucunda, güney Hindistan’daki geniş Tamil halkının, Semanglar’la Aborjin Malaylar arasında Malay Yarımadası’ndan Aborjin bir grup olan Senoiler’e bağlı olduğu ortaya çıkıyor.

M Hindistan’da, N ise muhtemelen daha batıda Basra bölgesinde doğdu

Batı Avrasya’da neredeyse hiç görülmeyen M, bize doğum yerinin Hindistan olduğundan şüphelenmemiz için birçok neden sunuyor. M en zengin çeşitliliğine ve eskiliğine Hindistan’da kavuşuyor. Başka hiçbir yerde böyle bir çeşitlilik ve böyle yüksek bir oranda kök ve kendine özgü ana dal türleri göstermiyor. Onun Hindistan’daki çok sayıda kızının en yaşlısı, M2, 73.000 yıl yaşında. Her ne kadar M2 yayılmasının tarihi kesin olmasa da, 74.000 yıl önceki Toba patlamasından sonra gelen toplu ölümlerin ardından nüfusun yerel bir telafisini yansıtıyor olabilir. M2, Andhra Pradesh’deki Chenchu avcı-toplayıcı Avustralya kabilelerinde açıkça görülüyor. Bu kabileler, Hindistan’ın geri kalanında bulunan M2 tipleriyle ortak atalara sahip oldukları kadar, M2’nin kendilerine has yerel değişik tiplerine de sahiptir. Sonuçta bütün bunlar M’nin doğum yeri olarak, daha batıyı, hatta Afrika’yı değil de Hindistan’ı belirlemek için güçlü nedenlerdir.

M ve R klanlarının sadece Hindistan’a has gelişiminin belki de en ilgi uyandırıcı tarafı, onların Afrika kökenli yürüyüş başladıktan sonra, 74.000 yıl önce meydana gelen Toba felaketinin yerel bir telafisinin işareti oldukları yolundaki ipucudur. Yıkılmış bir Hindistan, batıdan R tipleri tarafından ve doğudan M tipleri tarafından yeniden kolonize edilebilirdi. Bu resmi destekleyecek olgu, Kivisild ve çalışma arkadaşlarının Andhra Pradesh’in güneydoğu bölgesinde bulunan iki kabile topluluğu üzerinde yaptıkları yakın tarihli incelemelerinden geliyor. Bu topluluklardan biri, Avustralyalı Chenchu avcı-toplayıcılar, neredeyse tamamen M klanındandır ve Hindistan’ın karakteristik özelliklerini taşıyan ve sadece oraya ait olan başlıca M dallarının çoğunu taşımaktadırlar. Diğer grup Avustralyalı olmayan Koyalar, benzer bir şekilde Hindistan tipi M dallarının zengin bir çeşitliliğine (bütün kolların yüzde 60’ı) sahiptirler, ama sadece Hindistan’a özgü olan R tipinin yüzde 31’ini taşırlar. Chenchu ve Koya kabileleri böylece Hintli M ve R kollarının eski bir arşivini oluşturmaktadır ve bu dallar Hindistan Yarımadası’nın geri kalanında var olan maternal genetik
çeşitliliğin çoğunu içermekte ve atası niteliği taşımaktadır. Bu iki kabilelerin hiçbirinde batı Avrasyalı N tipleri görülmemektedir. R tiplerinin Koyalar’da bulunup Avustralyalı Chenchular’da bulunmaması, Hindistan Yarımadası’nın batıdan kısmen yeniden kolonize edilmesi fikriyle uyumludur. Onların açıkça Hindistanlı özelliği gösteren genetik kökleri ve yerelliğine rağmen, bu iki kabile arasında paylaşılan (örneğin tamamen uyuşan) hiçbir maternal genetik tip yoktur ve bu da onların eski ve birbirinden bağımsız gelişimine kanıttır.
http://www.evrim-teorisi.org/forum/images/misc/progress.gif

dilaver
15-07-2008, 01:54
Kota Tampan’daki aletleri kimler, ne zaman yaptı?

Kota Tampan ve Lenggong Vadisi kültürü üzerine, Penang’daki Sains Malaysia Üniversitesi’nden arkeolog Zuraine Majid kadar araştırma yapan kimse olmadı. Onun Lenggong Vadisi’ndeki birkaç kazı alanındaki geniş çapta araştırmaları, o büyük Toba patlamasının olduğu zamandan itibaren 7.000 yıl öncesine hatta sadece 4.000 yıl öncesine kadar yerel bir Yontmataş kültürünün var olmuş olabileceği sonucunu doğuruyor. Eğer durum böyleyse, bu, tek tarafı yontulmuş oval taş aletler hakkındaki en can alıcı sorulardan birine yanıt olabilir: Bunları kim yaptı? Bir kere bunlar hiçbir şekilde sofistike aletler değiller. Daha güzel görünen aletler, çok daha önce Afrika’da ve Avrupa’da ilkel insanlarca yapılmışlardı; o halde neden bu volkanik küllerin içine gömülü tek tarafı yontulmuş aletlerin Toba patlaması sırasında yaşamış modern insanlarca yapıldığı düşünülmesin?

Güneydoğu Asya’nın Paleolitik kültürleri üzerine en yetkili uzmanlardan ikisi, Avustralyalı arkeologlar Peter Bellwood ve Sandra Bowdler, bu aletlerin anatomik açıdan modern insanlarca yapılmış olabileceği konusunda Zuraina Majid ve Tom Harrison’a katılıyorlar. İlk olarak Zuraina Majid ve Tom Harrison, Lenggong vadisinde bulunan taş aletlerin çoğunun yaşının, modern insanlar dışındakiler tarafından yapılmak için fazla genç olduklarını düşünüyorlar. İkincisi, değil Lenggong Vadisi, Malay Yarımadası’nda bile başka modern öncesi insana rastlanmadı.


Perak Adamı

Zuraina’nın bu konudaki kozu, kendi ekibi tarafından 1990’da Lenggong Vadisi’nde, Gunung Runtuh Mağarası’nda birçok yayına konu olmuş Perak Adamı’nın bulunmasıdır. Uzmanlar, aynı taş alet sınıfıyla çevrili olan, modern insana ait bu tam iskeletin Australo-Melanezyan karakteristik özelliklerini taşıdığını belirledi. İskelet, aşağı yukarı 10.000 yıl yaşındaydı. Taş aletlerin modern insanlarla bu yakın tarihli birleşimi, Kota Tampan aletlerinin modern insanlarca yapılmak için fazla kaba saba oldukları yönündeki fikri çürütüyor. Ayrıca aynı yerde daha eski aletlerle bir süreklilik ilişkisi var, Zuraina bu ilişkinin teknik karşılaştırmalarla desteklendiğini öne sürüyor. Dolayısıyla en azından şimdilik, Perak Adamı, küllere gömülü daha eski taş aletlerin aynı (modern) insan türünce yapılmış oldukları yönünde en iyi yerel kanıt.

Güneydoğu Asya arkeolojisi üzerinde bir diğer saygıdeğer uzman Richard Shutler’dir. Kendisi, bu tür aletlerin güneydoğu Asya adalarına (yani bütün Endonezya, Malezya ve Filipinler adalarına) yaklaşık 70.000 önce Homo sapiensler tarafından ilk defa getirildikleri yönünde daha genel bir görüş bildiriyor. Shutler, böyle aletlerin kültürel geriliğin bir yansıması olduğu görüşüne karşı çıkıyor ve elde bulunan hammaddenin niteliğinin aletlerin yapımı için nelerin kullanılabileceğini belirlediği ve bıçak, bambu gibi daha sofistike aletlerin de kullanılmış olabileceği konusunda diğerleriyle aynı görüşü paylaşıyor.


O halde Kota Tampan kültürü kaç yaşında?

Onlarca yıl önce ilk defa tarihlendirildiğinde, 31.000 yıl sonucu elde edildi. Toba Yanardağı’nın külleri konusunda bu tarih jeologları ve hatta Peter Bellwood gibi arkeologları uzun uzun düşündürmüştü. Kafa karıştırıcı nokta, Toba’nın o tarihte büyük bir patlama gerçekleştirmemiş olmasıydı. Toba’nın son büyük patlaması, çok daha önce, 71-74.000 yıl önce gerçekleşmişti. İçlerinde gerçek tarihi bulanın da yer aldığı birkaç jeolog, daha yakın bir tarihte,aletlerin etrafını saran küllerin zaten 74.000 yıl yaşında olduğu konusunda görüş birliğine vardılar. Bu tarihleme kritiktir. Eğer Kota Tampan aletleri modern insanlarca yapıldıysa, bunlar Afrika dışındaki modern insanlar konusunda tarihi kesin olarak belirlenmiş en eski kanıttır. Böylece Avustralyalılar’ın ataları sanki Toba patlamasından önce Afrika’yı terk etmiş ve kıyılar boyunca ilerleyerek Malezya’ya gelmiş gibidirler.


Liujiang kafatası

Bölgedeki diğer bir kanıt, Uzakdoğu’da anatomik açıdan modern insanları 70.000 yıl önceden daha erkene yerleştirebilir. Bu, meşhur Çinli Liujiang iskeletidir. Çok iyi korunmuş bir kafatası ve birkaç diğer kemikten oluşan Liujiang, 1958’de gübre toplayan köylüler tarafından Guangxi Zhuang otonom bölgesinde Tongtianyan’da küçük bir mağarada keşfedildi. Bu insanın anatomik açıdan modern olduğuna dair hiçbir şüphe yok, ama baştan beri onun yaşı konusunda tartışmalar oldu.

Uranyumla yapılan tarihlendirmeye göre, 67.000 yaşında olduğu bildirildi, ancak tarihlendirilmiş jeolojik katmanlara göre tam olarak bulunduğu konum dikkate alındığında bundan şüpheye düşüldü. Aralık 2002’de, jeolog Shen Guanjun başkanlığında Çinli bir grup, mağaranın yeniden stratigrafik (tabakabilim) incelenmesi (civardaki bazı mağaralara doğru genişleterek) ve kafatasının tarihlendirilmesi için yürüttükleri çalışmanın raporunda, kafatasının yaşının 68.000’den az olamayacağını, 70.000-130.000 yıl arasında olduğunu ileri sürdü. Kafatası doğal çimento ile değişik çağlardan karışık maddeleri içeren bir lavlı, kabuklu, kemikli kırıntıların kaynaşmasıyla oluşmuş bir breş kütlesinin içerisinde bulunmuştu. İtibarlı bir dergi olan Human Evolution’da yayımlanan tezlerine göre, en düşük yaş sınırı olarak 68.000 yıl kesin görünüyor, çünkü bu belirleme breşin üzerinde yer alan ve onu çevreleyen sarkıtların yaşının çok yönlü değerlendirilmesine dayanıyor. (Sarkıtlar duvardan aşağı ya da zemin boyunca akan suyun biriktirdiği kalker tortusuyla oluşur.) Tercih ettikleri tarih olan 110.000 - 139.000 yıl öncesi, breşin içerisindeki katmanlaşmamış sarkıt ve kalker parçalarını esas alıyor ve bu tahmin spekülatif görünüyor.

Ben yanılmak pahasına, Toba’dan kaynaklanan kalın volkanik kül tabakası altından çıkarılan aletlerin bulunduğu Kota Tampan kazı alanını esas alarak, modern insanın Malezya’daki varlığını bu tarihe oturtmakta ısrar ediyorum. Esas aletler tartışmaz bir biçimde insan ürünü ve kül kesin bir şekilde gökyüzünden 74.000 yıl önce yağdı.Ama Kota Tapman aletlerinin modern insan elinden çıktığı görüşüne rağmen, yine de bu aletler teorik olarak diğer insanlar tarafından yapılmış da olabilir, zira yapanların kimliğini ortaya koyacak herhangi bir kemik kalıntısı kazı alanında bulunmuş değil. Bölgede bulunan, o eski çağlardan kalma tek modern insan kalıntısı, şimdi yeniden tarihlendirilmiş olan Liujiang kafatası ve güney Çin’de bulunan kısmi iskelettir. Modern insanın Flores’e (doğu Endonezya) ilk yerleşiminin tarihlendirilmesi, yayımlanmayı bekliyor. Böyle bir bağlantıyı esas almayı pekiştiren bazı sebepler var. İlk olarak, Avustralya’ya 65.000 yıl önce alçak su seviyesi sırasında yerleşim olduğu tezi, mantıksal olarak buna uyuyor. İkincisi, Afrika dışındaki genetik tarihlendirmelerin artan sayısı o tarihlere kadar uzanıyor. Su seviyesinin alçalmasıyla Avustralya’ya geçiş için oluşan bir sonraki uygun geçit yaklaşık 50.000 yıl öncesinde olmuş olmalı ki, bu diğer kanıtlarla pek uyumlu değil.

dilaver
15-07-2008, 01:56
Timor'dan Avusturalya'ya
74.000 – 65.000 yıl önce

Afrika dışındaki modern insan yerleşimlerinin genellikle kabul gören en erken arkeolojik kanıtları, yakın zamana dek Avustralya’da idi. Ancak bu hızla değişen bir durumdur. 1990’lara kadar, 40.000 yıl önce Avustralya ya da Yeni Gine’de yaşamış insanlara dair belirgin kanıtlar yoktu. Bugün görüyoruz ki, bu durum Avrupa için yapılan tarihlendirmelerde olduğu gibi, radyokarbonla tarihlendirme metodunun sınırlılığından kaynaklanıyordu. Ancak daha sonra, yeni tarihlendirme metotları uygulanmaya başladı. Luminesans adıyla bilinen tarihlendirme yöntemi, araştırmacılara radyokarbon tekniğinin 40.000 yıl öncesine uzanabilen sınırından daha ötelerini inceleme olanağı sağladı. 1990’da Richard Roberts ve Rhys Jones’un Avustralyalı jeolog ve arkeologlardan oluşan ekibi, kuzey Avustralya’daki Arnhem bölgesinin kıyısındaki kaya sığınağındaki ilk yerleşim için, 50.000-60.000 yıl öncesini tarihlendirdiler. Arnhem, Endonezya
Takımadası’nın en yakın adası olan Timor’un tam karşısındadır ve muhtemelen bundan dolayı ilk Avustralyalılar için yola çıkış noktasıdır.

Daha sonra Avustralya’ya dair tarihler oldukça anormal bir sapma yaşadı. 1996’da arkeolog Robert Fullagar Jinmium’un taş sanatı bölgesini inceledi. Buradaki sığınağın duvarı, “gagalanmış yüksük” şeklinde insan yapımı çentiklerle kaplıydı ve Fullagar, tortulara gömülmüş şekilde bulunan, oyularak işlenmiş kum taşının yere düşmüş bir parçasının, iki bağımsız tahmine göre 50.000 ve 75.000 yıl öncesine tarihlendiğini rapor etti. Hatta, termo-lüminesans yöntemiyle 116.000 ve 176.000 yıl öncelerine tarihlenen seviyelerde insan eli değmiş taşlar buldu ki; bu bulgu buranın, kıtada bilinen en eski insani faaliyet alanı, yukarda bahsedilen Arnhem bölgesindeki sığınaklardan 2-3 kat daha eski bir bölge olduğu anlamına gelir. Bu yeni tarihler infaal yarattı. Fakat düşen molozlardan bulaşan kum tanelerinin sebep olduğu kirlenmenin, dünyanın her tarafında insan yapımı aletler için aşırı eski tarihlendirmelere sebep olduğu gösterildiğinde, sorun çözülmüş gibi göründü. Bir başka deyişle, tarihler yanlıştı ve kum tanelerinin ayrı ayrı analizi, kirlenmenin sebep olduğu hataların saptanması ve üstesinden gelinmesini sağladı. Avustralya’daki en eski insan etkinliğinin tarihi, böylece 60.000 yıl öncesi civarında kalmış oldu.

Son zamanlarda yine, tartışmalara sebep olacak bir şekilde, insan etkinliğini
62.000 yıl öncesine kadar götüren tarihlemeler yayımlandı. Bu belirlemeler, güneydoğu Avustralya’da, Willandra Göller Bölgesi’ndeki Mungo Gölü’nde bulunan, ince yapılı, anatomik olarak modern insana ait iskeletin civarındaki toprak üzerinde uygulanan çeşitli yöntemlere dayanarak yapılmıştı. Bu raporlardan biri, o kadar süre önce o bölgede bulunabilmek için, ilk Avustralyalılar’ın, deniz seviyesinin alçak olduğu daha erken bir dönemde karşıya geçmiş olmaları gerektiğini işaret etmekteydi. Avustralya’ya geçiş için deniz seviyesinin alçalmasıyla ortaya çıkan “altın fırsat”ın 65.000 yıl önce gerçekleşmesi, anatomik olarak modern insan olan Mungo Gölü halkının kıtadaki en eskilerden olduğunu gösteriyor; çünkü bir önceki alçak deniz seviyesi bir 80.000 yıl daha önce, türümüzün daha ilk ortaya çıktığı dönemde yaşanmıştı.


Sadece tek bir altın fırsat

Akademik iddialar ve karşı tezler ne olursa olsun, çeşitli yerleşim yerlerinden
elde edilmiş, 60.000 yıl öncesinde Avustralya’da insan varlığını işaret eden kanıtların kesiştiği ortadadır. Bu tarihten hemen önce, kuzeyin büyüyen buz dağları arasında hapsolmuş suyun artması dünya okyanuslarındaki su seviyesinin derinliklerine kadar alçalmasına sebep olmuş ve Avustralya kıyıları bugünkü seviyenin 80 m (260 feet) altına inmişti.Buzul Dönem’in bu en düşük deniz seviyesinin tarihi 65.000 yıl öncesi olmakla beraber, dünya okyanusları yaklaşık 60.000 yıl öncesine kadar bu düşük seviyede kaldı ve sonra oldukça hızlı yükseldi.

62.000 yıl öncesinde Avustralya’nın kuzeybatı kıyılarındaki insanların varlığı, denizler ötesinden gelişlerinin de aynı tarihlerde olmasıyla tutarlı değildir; çünkü deniz seviyesinin düşük olduğu dönem 3000 yıl daha öncedir. Eğer Avustralya’ya varış tarihleri gerçekten 62.000 yıl önce olsaydı, birçok problem yaşanmış olmalıydı. Deniz seviyesinin ne kadar alçak olduğu, Timor’dan Avustralya’ya doğru denizi başarılı bir şekilde geçme şansını büyük ölçüde değiştirir. Kuzey Avustralya kıyılarından öteye deniz seviyesinin derinliğini gösteren haritadan, Avustralya ve Timor arasındaki mesafenin 100 m derinlikler arasında 160 km iken, 40 m derinlikte 220 km’ye, 20 m’de 470 km’ye çıktığını görebiliriz. 160 ve 220 km arasındaki fark küçük görülebilir, fakat insanın son 20.000 yıla kadar, dünyanın herhangi bir yerinde adalar arasındaki deniz geçişlerinde aşabildiği en uzun mesafe 180 km idi. Bunun arkeolojik kanıtları bulunan en eski örneği, yaklaşık 20.000 yıl öncesinde, Yeni Gine’nin kuzeyindeki Manus Adası’na yerleşimdir. Öyleyse, Avustralya’ya ilk yerleşimde tek ve uzun dönemli bir sürükleniş söz konusu değilse, Avustralya’ya geçişte altın fırsat 65.000 yıl öncesindeydi. Başka türlü 55.000 - 62.000 yıl öncesine dair Avustralya arkeolojik kayıtlarında görünebilmesi mümkün değildir. Her koşulda, çok temelli Avustralyalı maternal kollara dair genetik kanıtlara dayanan görüşe göre, Avustralya’ya ilk yerleşimin, sadece kazara ve rastlantısal bir sürükleniş sonucu gerçekleşmiş olması, ihtimal dahilinde olmayan bir senaryodur. Böyle bir varış tarihi, Avustralyalı nüfusun büyümesi için yapılan, 68.000 yıllık genetik tarih tahmini ile tutarlıdır.
http://www.evrim-teorisi.org/forum/images/misc/progress.gif

dilaver
15-07-2008, 01:57
Avrupalılar'ın kökeni
65.000 – 52.000 yıl önce

Avrupalılar’ın kökeni meselesi, sadece “müstakbel” Avrupalıların,“müstakbel” Asyalı ve Avustralyalılar’dan ayrı olarak Afrika’dan göç edip etmedikleri meselesi ya da onların modern insan davranışları gösteren ilk insanlar oldukları yönündeki efsaneyi çürütmek meselesi değildir. Bundan daha fazlasıdır. Onların olağandışı zengin ve çeşitli kültürlerinin kökeni ne? Tamamen yerel olarak mı gelişti, yoksa başka yerden mi getirildi? Neden bazı arkeologlar 20.000 - 50.000 yıl öncesi arasında, birçok farklı erken kültürel girişin, -hatta doğudan bir girişin- olduğunu iddia ediyor? Son Buzul Çağı’ndan önceki 25.000 yılın Avrupa’yla ilgili arkeolojik kayıtlarında, birbiri ardına filizlenen iki farklı kültürel dalgayla paralel giden açıkça belli eril ve dişil genetik izler bulunduğu öne sürülebilir. Bu, “Doğulu” bir kökenin çılgın bir tahmin olmadığını açığa vuruyor.

Avrupalılar’ın ataları, N (ya da Nasreen) klanı, güney Arabistan’a belki de 80.000 yıl önce gelen tek büyük göçün ilk dallarından birine aittir. Asyalı maternal genetik soyağacının kökenindeki bu sağlam pozisyonuna rağmen, Avrupalılar’ın ataları güney Asya’da on binlerce yıl beklemek zorunda kaldı. 50.000 yıl öncesine kadar beklediler, ta ki nemli, ılıman bir çağ Arap Yarımadası’nı yeterince yeşillendirip Bereketli Hilal’i açana ve onların Türkiye ve doğu Akdeniz üzerinden kuzeybatı taraflarına göç etmelerine izin verene kadar. Bu tür kısıtlamalar kuzenlerini, yani Hint Okyanusu kıyısı boyunca
güneydoğu Asya ve Avustralya’ya doğru giden ilk kıyı insanlarını etkilemedi.
Bunlar Avustralya’ya 60.000 yıl önce, Avrupa’nın kolonize edilmesinin çok öncesinde geldiler.

Asya’dan bakıldığında Avrupa, Eski Dünya’dan kuzeybatıya doğru bir çıkıntı halinde, ulaşılmaz bir yarımada, jeografik bir çıkmaz sokaktı. Jeografik açıdan olduğu kadar genetik açıdan da, Avrupalılar, benzer bir şekilde, Afrika kökenli insan soyağacının bir yan dalıdır. Çünkü Afrikalı olmayan ilk modern insanlar Asyalılar’dı, “yarımada Avrupa” daha çok bir alıcıydı, kendi yerel kaynaklardan ziyade daha erken tarihli Geç Paleolitik kültürel yeniliklerin kaynaklarından yararlanıyordu. Bu perspektiften bakıldığında, olgular, insanın esas biyolojik devrimi Avrupa ve doğu Akdeniz’de yaşadığı, dünyada geri kalan herkesin Avrupalı lideri takip ettiğini iddia eden arkeolojik/antropolojik efsaneyi çürütüyor.


Bereketli Hilal koridoru açılıyor

Maternal genetik soyağacımıza göre, bizim en eski Avrupalı kurucularımız,
nihayetinde 50.000 yıl yaşında güney Asyalı bir kökene dayanıyor. Onların kuzeye, 50.000 yıl önce Anadolu’ya gelmek için Bereketli Hilal’i bir koridor olarak kullanarak Libya ve Arap çöllerini geçmeleri gerekti. Moleküler saat üzerinde oldukça sık görülen hatalar göz önünde tutulursa, Zagros Dağları ve güneybatı İran’daki körfez bataklıklarından ilerleyen bu yürüyüşün tarihlendirilmesi için, bu göçe iklimin sunduğu fırsatlar açısından bakmalıyız. Bu bize, tıpkı bir ağacın gövdesindeki halkalar gibi, en kesin tarihleri verir. Son 100.000 yılın büyük bölümünde Bereketli Hilal koridoru kuru ve kapalıydı; ve sadece uzun buzul dönemlerinde buzun geçici olarak çekildiği kısa süreli iklimsel düzelmelerde açılıyordu.

55.000 - 65.000 yıl arasında dünya neredeyse aralıksız bir soğukluk ve kuraklık döneminden geçti. Bu dönemde Bereketli Hilal koridoru kapalıydı. Sonra, 56.000 yıl önceden bugüne doğru, dört ılık ve yağışlı dönem kısa aralıklarla birbirini takip etti. Bunların sonuncusu 51.000 yıl önce, en sıcak ve en uzun süreli olanıydı, yaklaşık 5.000 yıl sürdü. Aslında bu iklimsel düzelme o kadar ılık ve yağışlıydı ki, Hindistan’daki musonlar bugün olduğundan daha yoğundu ve böylece Bereketli Hilal koridorunun açılmasının yanı sıra, Negev Çölü gibi doğu Akdeniz’in kuru bölgeleri de Geç Paleolitik alet yapıcılar için yaşanabilir hale geldi. Eğer güney Asya’da çoğalmak ve doğu Akdeniz’e yayılmak için uygun bir zaman varsa, o zamandı. İklimsel ve arkeolojik dönem analizleri 45.000 - 50.000 yıl arasında yaşanan gür yemyeşil bir dönem olduğu fikrinde birleşiyor. Sanki Nasreen’in en yaşlı kızının ve onların ailelerinin doğu Akdeniz’e gelişlerinin moleküler zamanlaması fazla uzakta değilmiş gibi görünüyor.

Avrupalılar’ın Asyalı kökleri

Bu seyahat iki olağandışı sonuç doğurdu: Öncelikle, Avrupalılar’ın genetik anayurdu aslında 50.000 yıl önce güney Asya’da Pakistan Körfezi’ndeydi.
İkincisi, Avrupalılar’ın ataları Basra Körfezi’nden kuzey Mezopotamya’ya geçen ve Bereketli Hilal olarak bilinen bir koridoru izlediler. Bu koridor 51.000 yıl önce açıldı, Türkiye’ye ve nihayet Bulgaristan’a ve güney Avrupa’ya doğru göç etmeye imkân verdi. Bu, Avrupa’daki Aurignasyan kültürel hareketiyle çakışıyor gibi görünüyor. Güney Asya’dan Avrupa’ya ikinci yol İndus’tan Kaşmir’e ve İç Asya’ya doğru olmalıdır. Orada belki de 40.000 yıldan daha önce, avcılar ilk defa mamutlar gibi büyük hayvanları avlamaya başladılar. Bu avcıların bazıları gelişmiş yetenekleriyle Urallar’dan geçerek batıya Avrupa Rusya’sına ve oradan da Çek Cumhuriyeti ve Almanya’ya göç etmiş olmalı. Bu doğu istilası konusunda daha tutucu bir görüş, Orta Asya’dan ziyade Trans-Kafkasya’nın modern insanın Rusya’ya ilk giriş yolu olduğu yönündedir.

dilaver
15-07-2008, 01:58
Avrupa’nın beşinci kızı
52.000 – 45.000 yıl önce

Avrupa’nın maternal genetik prehistoryasının kapsamlı incelenmesiyle varılan en hayret verici sonuç, Avrupa’nın ilk kurucu dalı olan U5’in tanımlanması ve tarihlendirilmesidir. Başlangıçta, sadece dört başlıca doğu Akdenizli kurucudan birinin genetik büyük büyük kız torunu olan U5, Avrupa’ya göç etmişti. Bu Avrupa klanı, Yakındoğu ve Avrupa’nın karakteristik özelliğidir. Eskiliğine rağmen, sadece doğu Akdeniz ve Körfez bölgesine, Orta Asya’nın batısına, Akdeniz’i çevreleyen ülkelere, Avrupa’ya ve -eski bir alt dal olan U2 ile birlikte- Hindistan’a sıkışmış, doğu Asya’da bulunmamıştır. Bir bütün olarak bu klan, Yakındoğu’da 50.000 yıldan daha eskidir. Moleküler saate göre, Avrupa’nın beşinci kızı, U5 de 50.000 yıl yaşındadır ve Avrupa’ya giren ilk kolu temsil etmektedir; bir sonraki Avrupalı kurucu daldan 15.000 yıl önce giriş yapmıştır. Ama nasıl oluyor da doğu Akdeniz’de ilk defa görülen Geç Paleolitik Çağ ve Bulgaristan’daki ilk Aurignasyan için arkeolojik tarihler sırasıyla sadece 47.100 ve 46.000 yılı gösterdiği halde, Avrupa’nın genetik işareti, 54.000 yıl ile 50.000 yıl arasında Yakındoğu’ya ve kızı U5 yoluyla Avrupa’ya yayılıyor? Bu farklılık, radyokarbon tarihlerinin, “tavan etkisi” verip 40.000 yıl önceki herhangi bir çağın ölçümünde sistematik olarak kayıt dışı kalmasıyla açıklanabilir.

Her ne kadar U5 Avrupa’ya girişiyle aşağı yukarı eşzamanlı olarak Yakındoğu’da kökenlere sahip olsa da, onun uzantıları sadece sınırlı bir alanda başlıca olarak Türkiye’de ve Türkiye’yle İran’ın Trans-Kafkasya bölgelerinde yaşayan topluluklarda bulundu. Bunların içinde hâlâ Türkiye’den, Trans-Kafkasya’nın güneydoğusunda İran ve Irak’tan geçerek Zagros Dağları boyunca uzanan Bereketli Hilal’in eski sınırları içinde yaşayan Türkler, Ermeniler, Azeriler ve Kürtler bulunuyordu. Dikkate değer bir olgu, U5 Arabistan’da hemen hemen hiç görülmez; böylece bu halkların atalarının, Avrupa’daki ilk Aurignacian yerleşiminin başlıca kaynağı olduğu iddiası yanlışlanmıştır.

Aurignasyan alet yapıcılarının, onları 40.000 yıl önce batıya, orta Avrupa’ya, Pireneler’e ve İspanya’ya götüren hızlı hareketleriyle tam olarak örtüşen genetik işaretlere sahip miyiz? Her ne kadar U5 Avrupa’da artık her yerde bulunsa da, biliyoruz ki, Avrupa’nın en yaşlı büyük büyük torunu olan 40.000 yaşındaki U5a, en yaygın olarak kuzey İspanya’nın Bask bölgesinde görülür. Son Buzul Çağı boyunca Avrupa’daki yegâne sığınma bölgelerinden biri olan Bask bölgesi, batı Avrupa’nın diğer bölgelerine nazaran genetik çeşitliliğini daha fazla korumuştur.

U5, 50.000 yıl öncesine uzanan ilk Avrupalı ataları tanımlayan, hayatta kalmayı başarmış tek Avrupa kız kardeş alt koludur ve Ermeniler, Türkler, Azeriler ve Kürtler’in de paylaştığı bir ata tipidir. Onun ailesi, nereden geldiği ve kız kardeşlerinin kim oldukları hakkında ne biliyoruz? Genetik dalların soyağacını araştırınca, bir öykü gibi anlatabileceğimiz bir soyağacı elde ediyoruz: Avrupa, R’in (Rohani) genetik kızıydı, R, Nasreen’in genetik kızı, Nasreen de Afrika kökenli L3’ün kızıydı.Bununla birlikte, Avrupa maternal klanı hangi yolla doğu Akdeniz’e geldi ve Avrupa’yı kolonize eden kızı U5 nerede doğdu? Her iki N (Nasreen) ve Rohani grupları güney Asya dışında bilinmiyor, orada Nasreen kök tipleri düşük oranda bulundu ve Rohani’ye büyük bir çeşitlilikte rastlandı. Hindistan’daki birçok Rohani grupları başka yerde görülmedi. Rohani’nin Hindistan’daki büyük çeşitliliği onun dallarının nerede yayılmaya başladığını tahmin etmemizi sağlıyor. Bu en az 55.000 yıl önceydi, böylece Rohani’nin kızı Avrupa’nın doğu Akdeniz’e gelişi daha önceye tarihlendirildi ve Avrupalı dalların atayurdu olarak güney Asya önemli bir seçenek oldu. Bu yayılma tarihi bile Rohani klanının yaşını düşük olarak tahmin etmektir. Rohani Asya’da 55.000 yıldan daha eski olabilir, nitekim Rohani’nin Çin’de bulunan Asyalı iki altgrubunun yaşı daha büyük olarak tahmin edilmektedir.
http://www.evrim-teorisi.org/forum/images/misc/progress.gif

dilaver
15-07-2008, 02:00
Orta Asya’ya dört yol
45.000 – 40.000 yıl önce

Hem modern hem de ilkel insanlar açısından geçerli olduğu gibi coğrafik koşullar ve iklim, yeni gelen yerleşimcilerin daha sonra nereye gideceklerine karar vermelerinde etken oldu. Kurallar basit olmalıydı: Suyun ve güvenilir yağmurların yakınında kalmak, hareket ederken, çöllerden ve yüksek dağlardan uzak durmak, avları ve nehirleri takip etmek. Hint Okyanusu’nun etrafındaki kıyılardan geçerek Avustralya’ya uzanan yolun en eski ve en kolay seçenek olduğuna dair önemli sayılabilecek kanıtlar görüyoruz. Neden böyle olması gerekiyordu? O kadar kolay değildi: Öncelikle birkaç yüz kilometrede bir kâşiflerimiz büyük bir nehri ağız tarafından aşmak durumunda kalıyorlardı. Belli ki Avustralya’ya gitmek için yapmaları gereken buydu, dolayısıyla muhtemelen doğu Asya kıyısı boyunca aynı şeyi yapmışlardı. Her nehirde bazı insanların önünde sola dönmek ve iç bölgelere doğru nehir ürünleri ve avları takip ederek yol almak gibi bir seçenek vardı.

İlk Avrupalı kâşiflerden Marco Polo’nun bulduğu gibi, dağlar ve çöller Orta Asya’ya ulaşmayı deneyenler için müthiş engellerdi, birkaç patika dışında, yegâne giriş yolları nehir vadileriydi. Daha önce gördüğümüz gibi Afrika’dan ilk başarılı göç, bütün Afrikalı olmayanların atalarını, Hint Okyanusu kıyıları boyunca güneye, belki de 75.000 yıl gibi uzun bir süre önce taşıdı. Belki de bu kadar erken bir zamanda ayrıca doğu Çin ve Japonya gibi uzak bölgelere kadar gittiler. Böylece bütün Orta Asya bölgesini dolaşmış olmalılardı. Seyahatlerinin her noktasında nehirlerin yukarısına iç bölgelere gitmiş olmalılardı.

Himalayalar’dan dolayı Hindistan’ın kuzeyi dümdüz değildi. Hindistan’ın eskiden Asya ile tektonik çarpışması nedeniyle dağların yukarı kalkan kıvrımları, en yüksek Himalayalar’ın çok ötesinde Nepal ve Tibet’in her iki tarafında yayılıyor. Hepsi 3000 metreden yüksek olan geniş bir dağ grubu, Afganistan’dan doğuda Çin’deki Chengdu bölgesine kadar 6500 km’lik bir mesafe boyunca, Orta Asya’ya Hindistan kıyısından ulaşımı engelliyor. Bu grup kuzey Çin’de İpek Yolu’nun başlangıcından Tayland’a kadar yaklaşık 2500 km’lik bir mesafe boyunca, bir kuzey-güney bayır dizisi halinde dağ bariyerini güneye doğru yayarak, doğuda bir halı gibi buruşmuştur.

İlk defa Marco Polo’nun meşhur ettiği İpek Yolu, Himalayalar’ın kuzeyinde
onunla paralel giden, batıyla doğuyu birbirine bağlayan uzun bir ticaret yoludur. Dosdoğru Orta Asya’dan, mamut steplerinin en önemli yerinden geçer. İpek Yolu bugün olduğu gibi o zaman da Çin ile batı arasındaki birkaç bağlantıdan biriydi, şayet Singapur yoluyla güneyden kıyıları çevreleyen uzun yoldan kaçınılacaksa.


1) Himalayalar’dan İpek Yolu boyunca doğuya

Bugün İpek Yolu Singkiang’daki Taklamakan Çölü’nün hem kuzey hem de güney sınırlarından geçmektedir. Paleolitik Çağ boyunca, şu anda çöl olan bölge çoğunlukla sık çayırlardı ve kuzeye doğru bir suyolu dizisi, Tarim ve Dzungaria Nehirleri dahil, Tacikistan, Özbekistan, Kırgızistan ve Kazakistan’daki Orta Asya bölgelerinden Singkiang ve Moğolistan’a doğru avcılar için kolay bir doğu-batı yolu oluşturuyordu. Bu su yollarını ilk insanlar Orta Asya’ya gitmek için kullanmış olmalılar.

Taş Çağı uygulama imkânlarına bakılırsa, Orta Asya’ya ilk giriş yolunu, Çin’in 8.000 km batısına, İpek Yolu’nun batı ucundaki İndus’a almamız gerekir.

İlk Hindistan kıyı yerleşimcilerinin bir yan dalından söz ettiğimizi kabul edersek, onların İndus’a taşındıktan sonra ilk görevleri Hindistan’ın kuzeyi ve Pakistan’daki dağ engellerini aşmak olmalıydı. Bu engeller batıya, ta Afganistan’a kadar uzanıyordu. Dağların etrafından geçmek ve Afganistan üzerinden ta batıya kadar ilerlemek zor olacaktı ama imkânsız değildi; ne de olsa orası çöl kenarıydı. Marco Polo bu çölleri aştı, körfez ağzında Hürmüz’den yola çıkıp Afganistan üzerinden Kaşmir’e geçerek, Çin’e ve Kaşgar Şehri’ne doğru yüksek bir geçidi çaprazlayarak İpek Yolu boyunca ilerledi ve direkt olarak eski mamut stepinin ana merkezine ulaştı.

Marco Polo Kaşmir’e doğru çok daha kolay bir yolu deneyebilirdi. Pakistan kıyısından biraz uzakta doğuda, büyük İndus Vadisi kuzeye bir noktaya doğru yılan gibi kıvrılıyor, o noktada Kaşmir’e giden bir su bağlantısı var. Orta Asya’ya deniz seviyesinden fazla yukarıda olmayan bir başka yol, gene İndus’un başlıca ana suyolları yoluyla, Khyber Geçidi’ni kabule doğru çaprazlamak olmalıydı ve oradan Özbekistan’a, Kazakistan’a ve sonra Singkiang üzerinden doğuya gidilebilirdi.


2) Burma’dan Tibet’e doğru kuzeye

Mamut steplerine bugünkü tüccarlar tarafından pek fazla kullanılmayan ikinci giriş yolu, Himalayalar’ın doğusunda bulunur. Himalayalar’ın doğu kenarı, Hindistan platosunun kenarının Asya kıtasıyla çarpışması sonucu buruştuğu yerde birçok kıvrımdan oluşur. Bu buruşukluklar güney ve güneydoğu Asya’nın büyük ırmaklarının birçoğu için kanal oluşturmuştur. Batıdan doğuya doğru bu nehirler, Bangladeş’e akan Brahmaputra, Burma’ya akan Salween, Vietnam’a akan Mekong ve güney Çin’e akan Yangtzi’dir. Güneydoğu Tibet’den dışarı aktıkları için, bu dört büyük nehir 150 km boyunca paralel akmaktadır, birbirlerinden sadece birkaç kilometre uzaklıktadırlar. Bu dört nehirden sonuncusu olan Yangtzi’nin kaynağı, platonun kuzey kenarının yakınında kuzeydoğu Tibet ve mamut steplerinin başladığı yerdir. Bu nehir yolları önemlidir, sadece bugün birçok tüccar bunları kullandığı için değil; bunlar güneydoğu ve doğu Asya’da birbirlerine uzakta bulunan ve Hint-Pasifik kıyılarında denize boşalan dört nehir ağzından Tibet, Moğolistan ve Orta Asya’ya direk geçiş imkânı sağlarlar. Bu nedenle Tibet’in genetik açıdan Çinhindi ve güneydoğu Asya ile birçok ortak noktası vardır.


3) Çin’den İpek Yolu boyunca batıya

Bütün insanlık tarihi boyunca İpek Yolu, Çin’den batıya Orta Asya’ya giden tek yol olmuştur. Dolayısıyla, mamut steplerine giden alternatif bir yol doğu Asya Pasifik kıyıları olmalıdır. Kıyılara ilk yerleşenlerin öncü grupları Çin’e doğru bütün yolu kat etmiş ve İpek Yolu boyunca kuzey Çin’den batıya Moğolistan, Singkiang ve güney Sibirya’ya hareket etmiş olmalıdır.


4) Rusya’dan doğuya

Nihayet, batıdan doğu Asya’ya göç için daha kuzeyde dikkate alınacak bir başka yol vardır: Rusya Altay’ı olarak bilinen Asya Rusya’sı. Rusya Altay’ından Orta Asya’ya Son Buzul Çağı’nın ılık dönemleri boyunca 30-50.000 yıl önce en kolay direkt giriş yolu, stepleri doğrudan geçmekti. Güney Sibirya üzerinden doğuya doğru bir dizi göl ve su yolunu geçerek yolculuk yapan eski kâşiflerimiz, Baykal Gölü’ne Singkiang’ın kuzeyi ve Moğolistan’dan geçen bir yoldan ulaşmış olmalıdırlar. O devirde stepler, çimenler ve sık olmayan ormanlarla dolu olarak bütün bölgeyi kaplamışlardı. Belli ki bu yoldan geçen modern insanlar ilk önce Rusya Altay’ına gitmiş, yaklaşık 40.000 yıl önce hem Rusya Altay’ına hem de güney Sibirya’daki Baykal Gölü’ne ulaşmış olmalılardı.

Özetle, Orta Asya’ya dört muhtemel geçiş yolu olduğunu gördük: Üç tanesi Hint-Pasifik kıyılarından (batı, güney, doğu) ve bir tanesi Rusya’dan (kuzeybatı). Orta Asya’ya gelindiğinde, batı ve doğu Asya arasında su yolları boyunca öncü grupların izledikleri üç paralel yol vardı: İki tane güneyde Singkiang ve Moğolistan üzerinden ve bir tane kuzeyde güney Sibirya üzerinden. kuzeydeki yol, sadece interstadiallar (Bir Buzul Çağı’ndaki buzun geçici olarak çekildiği ılıman ara dönemler) süresince, 30-50.000 yıl önce Paleolitik Çağ’ın ılımlı dönemleri boyunca kullanılabilir durumdaydı.

dilaver
15-07-2008, 02:00
Kuzey Asya
40.000 – 25.000 yıl önce

Kuzey Asya haritası artık tamamlanmaya başlamıştı. 30.000 yıl önce eski Sovyetler Birliği’nin Rusya Altay’ından güney Sibirya’daki Baykal Gölü yoluyla doğudaki Aldan Nehri’ne kadar uzanan ormanlık güney kısmının geniş bir bölümü, kendileriyle eşzamanlı Avrupa Geç Paleolitik kültürüne benzer bir teknolojisi olan ilk modern insanlar tarafından kolonize edilmişlerdi. Hatta Kuzey Kutup çemberine bile yaklaşık 40.000 yıl önce Ural Dağları’nın kuzeyinden giriş yapılmıştı. Kuzey Avrasya’daki Geç Paleolitik teknolojisinin güneye, Sarı Nehir’in kuzey dönemecindeki İç Moğolistan’a taşındığına dair bazı işaretler bulunmaktadır, ama elimizdeki kanıtlara göre o zamanlar böyle kültürel etkileşimler daha güneye Çin’e kadar ulaşmamış gibi görünüyor. Doğu Sibirya’dan Avrupa’ya uzanarak Büyük Asya mamut steplerini dolaşan avcı-toplayıcılar hakkında Dale Guthrie’nin görüşleri, 30.000 yıl öncesinin arkeolojik kayıtlarında şekilleniyor. Onun güney steplerin yeni yeni “mongoloidlerin” atayurdu olmaya başladığı yönündeki tahminleri o dönem ve Sibirya için oldukça spekülatiftir. Öncelikle, daha önce belirtildiği gibi, bu kadar erken bir tarihe ait, tartışmasız mongoloid olan hiçbir kalıntı bulunamamıştır. Bütün bildiğimiz, bu ilk dönemde güney Sibiryalılar Avrupalı Cro-Magnonlar’a benziyordu. Benzer bir kültürü paylaşıyor ve en azından Y kromozom dallarının bize anlattığı hikâyeye göre, kuzey Avrupalılar’la aynı genleri taşıyorlardı. Bir batılı kültürel çekim noktasının muhtemel kanıtı olarak, o zamanlar mamut kültürünün ilk ortaya çıkışı çok daha batıda orta ve doğu Avrupa’da gerçekleşmiş gibidir.

dilaver
15-07-2008, 02:01
Yeni Dünya'ya Giriş
25.000 – 22.000 yıl önce

22-25.000 yıl önce Alaska’ya girdikleri zaman Bering Boğazı toplulukları nasıl görünüyordu? Çok dilli, çok çeşitli görünümde ve çok renkli miydiler? Ya da tamamen kaynaşmış topluluklar mıydı? Böyle düşünmüyorum: Beringia farklı kültürlere sunacak değişik kaynakları ve yöreleri barındıran geniş bir alandı. Kaçınılmaz karışmanın yerine, kültürel ve genetik çeşitliliğin bir kısmının
ayrı etnik gruplar halinde korunmuş olması daha olasıdır. Bir başka deyişle, Amerikan yerlilerinin bütün atalarının Last Glacial Maximum’dan (LGM) ve Clovis’ten önce Beringia’ya ve Amerika’ya girişi, A, B, C, D ve X kurucularının çoklu paralel girişlerinin resmini yansıtıyor. Bu, kuzeydoğu Avrasya stepleri ve Asya’nın doğu kıyısından gelen öncü gruplar tarafından birçok değişik yoldan gerçekleştirilmiş olmalıdır. Onlar muhtemelen Avrupalılar, Ainular ve bazı Pasifik Adalılara benzeyen çeşitli görünümleri taşıyorlardı. Bazıları daha çok Kuzey Mongoloidler ve günümüzdeki Amerika yerlileri gibi görünüyordu.


Amerika’ya yerleşim

Bu gruplar Amerika’ya yayılıp çoğaldıklarında, kemikleşmiş çok milliyetli bir Birleşmiş Milletler ekibi gibi hareket etmedi. Yeni gelenler Yeni Dünya’da kök saldıklarında yeşeren kültürlerin kökeni çeşitli Asya anayurtlarından gelen ayrı ve kendine has fiziksel, genetik ve kültürel öğelere dayanıyordu. Bu tablo arkeolojik kanıtlarla destekleniyor gibi gözüküyor. Clovis öncesi dönemden kalma insan izleri için sürdürülen araştırmalar sonucunda, kuzey ve güney Amerika’da Clovis katmanlarının altından ve daha erken dönemin Clovis olmayan yerleşim yerlerinden bazı aletler çıktı. Bu aletler Clovis’ten tümüyle farklı geleneklerden geliyordu ve Asya yakasında değişik benzerlere sahipti. Değişik kültürlerin birbirine paralel kolonizasyonlarından beklediğimiz
de budur.

İlk Amerikan topluluklarının farklı fiziksel görünümlerinden ötürü, onlar arasında açık genetik farklılıklar görmeyi ummamız gerek. Torroni ve Wallace’ın not ettikleri üzere mtDNA alt gruplarının kabilesel farklılıkları için belirgin olan eğilimde böyle değişiklikler görülmektedir. Amerikalar’ın tek aşamada kolonizasyonunun kanıtlarından biri kuzey, orta ve güney Amerika’da A, B, C ve D majör gruplarının her zaman bulunuşu olmuştur. Bununla birlikte Amerika kıtaları oldukça geniştir ve çeşitli Amerikan halklarında beş kurucunun göreceli oranlarında belirgin farklılıklar vardır.

Bugünkü etnik gruplanmalar kabileye-özgü mtDNA tipleriyle birbirinden ayrılır. Bazı istisnalar haricinde, etnik gruplar arasında bireysel mtDNA tiplerinin paylaşımı çok azdır. Bu, tek kurucu dalganın hemen değişik gruplara ayrıldığı ve bu grupların birbirinden ayrı kalarak kurucuların farklı oranlarına sahip oldukları şeklinde yorumlanmıştır. Ama kanıtlar, Beringia üzerinden farklı Asya kaynaklarına uzatılabilecek birçok ayrı genetik dalı barındıran ilk kolonizasyondan söz eden alternatif resimle örtüşmektedir. Subarctic bölgesindeki en uç durumları zaten görmüştük; orada Alaska’daki Na-Dene dili konuşanlar ve kuzeybatı kıyısındakiler sadece A2 grubunun Amerikan maternel tiplerini taşıyorlardı. Gördüğümüz gibi, Na-Dene ve Inuit-Aleut’taki tek A2 kolunun sebebinin, atalarının tek genetik kola indirgenmesiyle sonuçlanan yakın tarihli toplu ölümüne dayandığı düşünülmektedir.

A grubunun aşırı derecede ön plana çıkışı, kuzey Amerika boyunca 50.paralelin kuzeyine kadar devam ediyor ve sadece Na-Dene ve Inuit-Aleut’u değil; ayrıca Amerind, Canada ve Great Lakes’in Algonquian dilini konuşan kuzey Ojibwalar’ını içeriyor. Onların dahil oldukları A grubu başka yerde bulunmayan üç kendine has tiple karakterize olmuştur. Sadece bu değil, ama Ojibwalar yüzde 25 oranıyla ender bulunan X tipinin en yüksek oranını taşır ve daha sıradan türevlerinden ziyade tek dominant Y kurucusuna sahip olma şerefini taşırlar. Her ne kadar bir Amerind dili konuşuyor olsalar da, Ojibwalar, Na-Dene dilini konuşanlarla Subarctic bölgelerini ve hatta bazı kuzeyli kültürel öğeleri paylaşırlar. Onların kendilerine has ama göreceli olarak çeşitli genetik oluşumları, gerçek kurucu dalları yüksek oranda taşımaktadır. Buna göre, Ojibwa ve bağlantılı gruplar,Na-Dene’lerde olduğu gibi buzul çağı boyunca neredeyse tamamen soyu tükenmiş bir topluluk olmaktansa, kuzeyde izole olmaları nedeniyle, Beringli kökenlerinden ve nihayetinde kuzeydoğu Asya’dan türeyen ayrı bir genetik kimliği korumuşlardır.

Kurucu maternel A grubunun genel dağılımı Subarctic kuzey Amerika’da yüzde 100’den güney Amerika’da genelde düşük oranlara değişerek açıkça belli bir düşüşü gösteriyor. Kuzey Amerika’nın geri kalanında A’nın ayrıntılı resmi, sıfırla yüksek oran arasında gidip gelen çok çeşitli bir resimdir. Amerikalar’daki eski DNA üzerinde yapılan çeşitli incelemeler A grubundan tamamen yoksun halkları ortaya çıkararak, önceki resmin daha büyük farklılıklar gösterdiğini öne sürüyordu. Kuzeydeki bir örnek Büyük Tuz Gölü’nün Fremont kültürüydü, diğeriyse güney Amerika tipindeki sadece C ve D’yi taşıyan yok olmuş Fugean kabileleriydi. X’in dağılımı, bu dal kuzey Amerika’nın en kuzeyinde iki etnik gruba sıkıştırılmış olduğuna göre, Amerindler’deki A resminin abartılmış halidir. Bununla birlikte D grubu, kuzey Amerika’da düşük oranlarda bulunmuştur ama güney Amerika’da, özellikle ekvator bölgesinde oldukça yüksek oranlardadır.

Özetle, Amerika boyunca beş kurucu dalın bölgesel oranlarında görülen aşırı çeşitlilik, orijinal kolonizasyonda ayrı etnik kolların bulunduğu görüşünü destekleyebilir (her ne kadar başka açıklamalar olsa da).
http://www.evrim-teorisi.org/forum/images/misc/progress.gif

dilaver
15-07-2008, 02:02
Kayıp kıta: Beringia

11.000 ila 25.000 yıl önce, deniz seviyesi o kadar düşüktü ki, Bering Boğazı, Asya ve kuzey Amerika arasında karadan bir köprü durumundaydı. Gerçekte, Beringia bir köprü olmaktan daha fazlasıydı; en geniş uzamıyla 1,3 milyon km2’lik (500 bin mil2) başlı başına büyük bir kıtaydı. Buzla kaplı değildi, dahası tundra otlaklarıyla otçul memeli hayvan sürüleri için elverişli bir bölgeydi. Yazlar şimdikinden kesinlikle daha serindi, ama aksine kışlar daha ılıman ve yumuşaktı. Kara köprüsünün varlığını sürdürdüğü dönemin büyük bölümünde, daha güneyde sürekli olarak buz tepeleri vardı ve 15.000 - 20.000 yıl önce aradaki buz koridoru, muhtemelen Amerika’nın kuzeyi ve geri kalanı ile arasındaki bağlantıyı engelleyecek şekilde kapalıydı. Sibirya çevresi, o dönemde bir kutup çölü olan kuzey Amerika’dan daha çekici sayılmazdı. Böylece Beringia ve Alaska’nın batı kesimleri, her iki kıtadan da ayrı olarak, fiilen bir buz devri sığınağı haline geldi. Amerika’ya ilk yerleşenlerin özgün genetik yapısından arta kalanları barındıran Beringia sığınağı sayesinde, şimdi, A1 / A2 grubu gen ağacı üzerinden Amerika’yla bağlantısı olan Na-Dene ve Inuit-Aleut’un, neden yoksul çeşitliliğiyle Amerikalılar’ın geri kalanından epeyce farklı göründüğünü görebiliriz.

dilaver
15-07-2008, 02:02
Neden Buzul Çagları Oluşuyor ?

Buzulların geri çekilip ilerleme zamanlarını ve bunun sonucu olarak deniz seviyesinin inip çıkmalarını etkileyen hareketlere dair görüş, hâlâ 19. yüzyıl jeologlarının öncülük ettikleri astronomik teorilerin etkisi altındadır. Bu teoriler, 20. yüzyılda buzul çağının “Milankovitch hipotezi” adı altında toplandı.


Milankotovich Modeli

Milutin Milankovitch bir Sırp’tı. 1914’te Birinci Dünya Savaşı patlak verdiği zaman yanlış ülkede yakalanmış ve tutuklanmıştı. Şansına, kendisine dostça davranan Macar bir profesör şartlı tahliye olmasını sağladı ve Budapeşte’ye götürdü. Orada, Milankovitch, Macar Bilimler Akademisi’nin kütüphanesinden faydalandı. Savaşla ilgisiz olarak, hesaplamalarına devam etti ve 1920’de tahminlerinden oluşan ilk koleksiyonu yayımladı. Milankovitch’in dehası astronomik döngülerin doğru bileşimi ve titiz hesaplamalarında yatıyordu. 1958’de öldüğünde, kendi tahminleriyle jeologların bulguları arasındaki çeşitli farklılıklardan dolayı teorisi kısmen gözden düşmüştü. Fakat daha sonra, jeologların daha eski yöntemlerinin, özellikle karbon tarihleme yönteminin
gerçeğe uygunluğu eksik bulundu ve Milankovitch modeli zaman testinden
geçerek zafer kazandı.

Ama şunun farkına varmak önemlidir ki, dünyanın sıkça gerçekleşen ve görünürde rasgele olan ısınma ve soğumaları, hepsi farklı hızlarda olan en az üç gökyüzü döngüsünün karşılıklı etkileşimiyle büyük ölçüde açıklanabilir. Bu döngüler Güneş’in ısısının dünyanın çeşitli bölgelerine ulaşımını karmaşık bir şekilde etkileyebilir. Buzulların yerleşmesi konusunda önemli bir nokta da, yaz boyunca kuzey bölgelerine ulaşan ısının düşmesi sonucunda bir önceki kıştan kalan karların eriyememesidir. Güneş ısısı üç önemli gökyüzü döngüsüyle kontrol edilir. Bunlar sırasıyla 100.000 yıllık gerilme, 41.000 yıllık eğilme ve 23.000 yıllık sallanma döngüleri olarak adlandırılabilir.


Gezegenimiz Güneş’e serenat yaparken…

Her yıl Dünya Güneş’in etrafında dönerken, yörüngenin çeşitli noktalarında
sırasıyla daha yakın veya daha uzağa gelir. Bu hareket elips şeklindedir ve Güneş elipsin tam ortasında değil, bir ucuna daha yakındır.100.000 yıllık bir dönemin sonunda bu elips bir şekilde gerilir ve neredeyse daire haline gelinceye kadar kısalıp yuvarlanır. Bu bir çocuğun çemberini alıp onu bir elips yapacak şekilde biçimini bozması gibidir. Devrenin sonunda, Dünya ile Güneş arasındaki mesafe 18,26 milyon km kadar değişir. Her ne kadar bu devre sonunda iletilen ısıdaki fark nispeten düşük olsa da, bunun dünyanın iklimine etkisi herhangi bir nedenle diğer iki mekanizmanınkine nazaran daha büyüktür. Henüz Güneş’in döngüsü bir buzul çağını oluşturacak nitelikte değildir, ama devrelerden yola çıkılarak gelecek büyük buzul çağının ne zaman başlayacağı doğru tahmin edilebilir.

Bildiğimiz kadarıyla Dünya’nın dönüş ekseni, Güneş’e belli bir açıyla eğilmektedir. Bu daha çok dimdik durmayan bir topacın durumunu hatırlatır.
Bu yaz ile kış mevsiminin oluşma nedenidir, nitekim yerküre bir döngü boyunca önce kuzey sonra da güney tarafını Güneş’e sermektedir. Eğim 23,5 derecedir ama yaklaşık 41.000 yıllık bir dönem içinde 21,5 ila 24,5 arasında değişmektedir. Eğim ne kadar yüksek olursa, Güneş’den gelen ısı konusunda mevsimsel dengesizlik artar ve ılımlı havalarda yaz boyunca kalan buz miktarı azalır. Günümüzde, bu eğim miktarlarının iki aşırı ucu arasında nötr bir noktadayız, böylece bir buzul çağı için elverişli bir koşul oluşmamış oluyor.

Dünya, başka yönlerden bir çocuğun topacına benzer. Sadece Güneş’e 23 derecelik bir açıyla eğildiği için değil, ama ayrıca kendi ekseni etrafında dönerken yavaş bir piruvet (dansta kendi ekseninde ayak ucunda dönüş) yapıyor gibi hareket eder. Eğer dünyayı güneş etrafındaki yörüngesinde takip edebilecek bir konumda olsaydık ve yükseğe oturup tam kuzey kutbunun tepesinden baksaydık, kutbun her 22-23.000 yılda yavaşça bir daire çizdiğini görürdük. Eğer hayali bir cam küreden güney kutbuna baksaydık, onun 180 derece faz farkıyla aynı daireyi çizdiğini görürdük. Eksenin bu kendi etrafındaki dönüşüne eksen presesyonu denir ve dönüp duran bütün topaçlar bunu yapabilir.

Bu presesyonun Dünya’ya etkisi, Dünya’nın yörüngenin değişik kısımlarında
Güneş’e gösterdiği yüzünde yavaşça değişiklik olmasıdır. Presesyon eğilme açısını değiştirmez, sadece eğimin yönünü değiştirir. Sonuç olarak, gelecek 11.000 yılda, 21 Haziran, Avrupa’da ve kuzey Amerika’da kışın ortası ve Avustralya’da yazın ortası olacak. Bu yavaş dans için süslü bir tabir
“ekinoksların presesyonu”dur.

Günümüzde, Kuzey Yarımküre, Dünya’nın Güneş’e en uzak olduğu yerde yazı yaşıyor. Güney Yarımküre de, Dünya’nın Güneş’e en yakın olduğu yerde yazı yaşıyor. Böylece bugünkü presesyon Kuzey Yarımküre’de buzlanmayı teşvik ediyor. Yaklaşık 20.000 yıl önce son büyük Buzul Çağı’nda benzer bir durum vardı, ama diğer iki devrenin pozisyonu ibrenin buzullaşmadan yana olmasını sağladı. Yaklaşık 11.000 yıl önce yazlar Kuzey Yarımküre’de daha sıcaktı, bu nedenle kutuplardaki buzlar daha çabuk eridi.

Milankovitch devreleri, böylece birbirinden zaman açısından bağımsız üç zarif ve görkemli danstan oluşur. Bunlar yeryüzü ikliminde öngörülebilir
değişikliklere yol açar. Son 20 yılda jeologlar ve okyanusbilimciler buzulların
erime ve donmalarının geçmişteki aşamaları ve değişikliklerini dolaylı olmayan yollarla ölçebilecekleri yöntemler geliştirdi. Bu ölçümler hassaslaştıkça, geçmiş 2 milyon yılda buzulların ilerleyip gerilemelerini öngörmekte, Milankovitch’in modeline daha iyi uyar hale geldiler.

dilaver
15-07-2008, 02:03
Buzul Çagı'nın Sıgınma Bölgeleri
22.000 – 19.000 yıl önce

Afrika’daki insanlar, tıpkı ataları gibi, geçen 2 milyar yıldaki her büyük soğumada büyük sıkıntı çektiler. Sahra, bütün kuzey Afrika’yı kaplayacak
ölçüde genişledi. Kalahari Çölü güneybatı Afrika’nın büyük kısmına yayıldı; kuru, ağaçsız otlaklar kıtanın Sahra’nın güneyindeki bölümünün büyük kısmını kapladı. Orta ve batı Afrika’nın büyük yağmur ormanları ekvatoryal orta Afrika’daki küçük adalara ve batı Afrika’da Gine kıyılarına çekildi. Kurak savanların yeniden yayılması, doğu Afrika’daki insanları güney Afrika’dakilerden ayırdı. Toplayıcı-avcılara, sadece adalarla birlikte kuru otlakların yanındaki çalılık sığınma bölgeleri kalmıştı.

Buzdan kaleler yapmakta Kuzey ve orta Avrupa’nın, Amerika’yla birlikte liderliği ele aldığı göz önünde bulundurulursa, anatomik açıdan modern insanlara ne olduğunu sorabiliriz. Hepsi oraları terk mi etti, yoksa öldüler mi ve sonradan Ortadoğu’dan gelen yeni bir grup yerlerini mi aldı? Kuzenlerimiz Neanderthaller zaten Son Buzul Çağı’ndan (LGM) 10.000 yıl önce ortadan kaybolmuştu. Arkeolojik kayıtlar bize Buzul Çağı öncesi Avrupalılar’ın orada yaşadıklarını söylüyor ama, Afrika’da olduğu gibi, onlar da güney tarafında üç belki de dört ılımlı kuşağa sıkıştı. Ayrıca genetik izler de bize bu Buzul Çağı sığınma bölgelerinin kökenleri ve insanlarının niteliği hakkında birçok şey anlatıyor, ama bunun arka planını çizmek için öncelikle arkeolojik kayıtlara gitmemiz lazım.

Kuzey Avrupa’nın büyük kısmında LGM boyunca kimse yaşamıyordu. Avrupa’nın Paleolitik insanlarının çekildikleri güney Avrupa’da üç ana sığınma bölgesi vardı. Batıdan doğuya bu alanların ilki, Pireneler’in iki yanında Bask bölgesinde, Fransa’nın ve İspanya’nın (Fransız köyü Solutre’den ismini almış) Solutrean kültürünün taş “yaprak uçları” ile karakterize olmuş birer kısmından oluşuyordu. Bu güneybatı sığınak bölgesi belki de teknolojisini kuzeybatı Avrupa’dan alıp, -kültürleri genel olarak Epi-Gravettian olarak adlandırılan- diğer sığınma yerlerinden kültürel açıdan ayrılıyordu.

İkinci sığınma yeri İtalya’ydı, az çok sürekli bir şekilde yerleşime açılmıştı.
Üçüncüsü, Karadeniz’in kuzeyinde iki büyük nehir Dinyeper ve Don ile tanımlanmış ve güney Avrupa’nın geri kalanından Karpat Dağları ile ayrılmış geniş bir alan olan Ukrayna’ydı ve burası LGM’de kısmen buzla kaplıydı. Orta Avrupa’da başka iki yerin daha LGM boyunca küçük çapta insan yerleşimine açık olduğu öne sürülüyor. Buralar Karpatlar’ın hemen güneyinde batı
Slovakya ve Karpatlar’ın hemen doğusunda Karadeniz’in kuzeybatı kıyısında Moldova’nın Dinyester Nehri Havzası.

Doğu Avrupa yerleşim bölgeleri, Geç Paleolitik mamut kültürünün son filizlenmesine ev sahipliği yaptılar. LGM en yüksek noktasına ulaştığında,
aktivitelerin odak noktası batı Slovakya’dan çıkıp çoğunlukla Moldova ve Ukrayna’ya ama ayrıca güne ye, Macaristan’a yöneldi. Ama özellikle büyük soğukluk süresince doğu Avrupa’daki sürekli insan yerleşiminin -ve hatta yayılmasının- en iyi kayıtlarını Ukrayna’da ve daha kuzeyde Dinyeper ve Don Nehirleri’nin kuzeyinde Rusya düzlüğünde buluyoruz.


Kuzey Asya buz içinde

Himalayalar’da bir buz şapkası oluştu ve çöller LGM boyunca bu dağlarda 40. paralele ve güneyde orta Asya’da yayıldı. Orta Asya’nın güneyindeki halklar her ne kadar tamamen ortadan yok olmasa da, büyük oranda azalmıştı - en azından Tibet’te. Bu durum, güney, doğu ve güneydoğu Asya’yı orta ve kuzey Avrasya’dan önemli ölçüde ayırdı, ama bu orta bölgelerde ve kuzeyde hayatın durduğu anlamına gelmiyor. LGM boyunca sürekli donmuş vaziyetteki sınırlar (permafrostlar) 50. paralele kadar indi. Bu sınırtlar tundralardaki insan yerleşimini engelleyemedi. Hatta LGM’de permafrost çizgisinin kuzeyinde insan aktivitesine dair kanıtlar vardı, özellikle Rusya düzlüklerinde ve kuzeydoğuda Sibirya’da Talitskogo’da. Güney Sibirya’nın avcı-toplayıcıları kendi özel Siberya kültürünü geliştirerek sürekli olarak bazı yerleşmeleri, özellikle Yenisey Nehri’ndeki Afontova Gora’yı mesken tuttular.

Tundra steplerinin ve orman steplerinin dar arazileri, büyük otoburlar
konusunda zengindi, Rusya Ovası’ndan kuzeydoğu Sibirya’ya doğru doğu taraflarına sıkışmış durumdaydı. Aşırı sert iklim koşullarına rağmen, buna uyum sağlayabilen avcılar için zengin av olanakları vardı. Bu bölgelere dağılmış, tarihleri o dönem olarak tespit edilen arkeolojik yerleşmelerden toplanan kanıtlara bakılırsa avlandılar da.
http://www.evrim-teorisi.org/forum/images/misc/progress.gif

dilaver
15-07-2008, 02:05
Genetik devamlılık ve Son Buzul Çagı

Buzlar etrafı ele geçirdiği zaman insanların ne yaptıkları hakkında, çıkarılan kültürel tablodan ziyade, insanların yok oluşu ve göçleri konusunda -gerçek anlamıyla nereden geldikleri ve nereye gittikleri hakkında- genetik kayıtlar bize daha fazla şey anlatabilir mi?

Genetik izler o zamana ait arkeolojik kayıtlara oldukça iyi uyabilir ve uyuyor da, ayrıca Avrupalılar’ın köklerine dair daha geçerli ve genel bir şey anlatıyor: Modern Avrupalı kolların yüzde 80’i gerçekte Buzul Çağı’ndan önce Avrupa’da hazır bulunan atalardan türemiştir.

Doğudan kuzey ve batı Avrupa’ya yayılmış olan önemli bir Avrupalı maternal klan HV, belki de 33.000 yıl önce en erken Geç Paleolitik’in başlangıcını haber veriyor. HV klanı şimdi geniş bir alana yayılmış ve hatta neredeyse eşit olarak Avrupa’da dağılmıştır. H bunların hepsinin en ortak koludur. Bu her zaman böyle değildi ve H klanının muhtemelen Bask bölgesinde doğmuş spesifik kız kardeşi V, bunun neden her zaman böyle olmadığını bize anlatıyor. Arkeoloji, Buzul Çağı’nın hüküm sürdüğü zamanlarda Bask bölgesinin güneybatı sığınak alanının kuzeybatı Avrupa’nın halkları ve kültürlerini nasıl kendisine sürüklediğini gösteriyor. Batı Avrupa İtalya’dan dağlarla ayrıldığına göre, Buzul Çağı’ndan sonraki tersine gidişte, insanlar Bask bölgesinden yeniden çıkarak, Atlantik kıyısı boyunca kuzeye yayıldı diye tahmin edebiliriz. En yüksek orana, çeşitliliğe ve en fazla eskiliğe Bask bölgesinde sahip olan maternal altgrup V’nin Buzul Çağı sonrası yayılımının bıraktığı tablo budur. Kuzeye gittikçe bu grubun oranı düşmektedir ve İtalya’da oldukça düşük oranlarda bulunur. LGM’den sonra V, Bask bölgesinde kısa sürede yükseldi. Pre-V atanın tarihi LGM’den çok uzun süre, 26.000 yıl önce olarak bulundu. Pre-V grup, doğulu kökleriyle uyumlu olarak, hâlâ Balkanlar’ın ta doğusunda ve Trans-kafkasya’da bulunmaktadır. V’nin Buzul Çağı sonrası yayılması bile (batıda 16.300 yıl) bu senaryoya uyuyor. Aynı model, doğudan kuzey Avrupa’ya göç eden ve kuzey ve batı Avrupa’yı mesken tutan Y kromozom izi Ruslan’da da görülüyor. Bugünkü resmin gösterdiğine göre, Ruslan maksimum oranına yüzde 90’la İspanya Bask bölgesinde ulaştı. Daha sonraki en yüksek orana batı ve kuzey Avrupa’da rastlanıyor.

Öte yandan Alpler tarafından üst sınırı çizilen İtalya, kuzey halkları için bir sığınma bölgesinden ziyade LGM’den daha önce de var olan Akdenizli halkın sürekli kaldığı bir yerdi. Bu durum, bölgede bulunan varlığını sürdürmeyi başarmış buzulöncesi mtDNA kollarının yüksek (üçte birden fazla) oranıyla belli olmuştur. Bu örneklerden görüyoruz ki, sığınma bölgeleri, LGM süresince bu kuşaklarda doğan kolların dramatik yayılmalarıyla ve ayrıca buzul öncesi dönemden kalan varlığını sürdürmeyi başarmış kolların yüksek oranda bulunmasıyla karakterize olmuştur. Son örnek şüphesiz Ukrayna’daki bir sığınma bölgesinin içerdikleridir, arkeoloji tarafından öngörüldüğü gibi, buradaki buzul öncesi maternal kolların yüzde 31’i korunmuştur. Biraz daha az tatmin edici bir örnek, buzul öncesi kolların yüzde 24-26’sını elinde tutan güneydoğu Avrupa ve Balkanlar olarak görülebilir.

Yüzde 20-34 arasında bir oranda modern Avrupalı mtDNA kollarının LGM öncesinden kaldığı kesindir, ama bu, bugün bulunan geride kalan kolların Avrupa’ya LGM sonrasında dışarıdan girdikleri anlamına gelmemektedir.Hayır, onların çoğu yereldi. Bugün modern Avrupalı dallar içinde, yüzde 55’inin kökeni o döneme, yani Buzul Çağı’nın hemen sonrasına (Son Geç Paleolitik)dayanıyor ama bunlar, V hablogrubu gibi, muhtemelen daha önce var olan Avrupalı kollardan geliyor ve insanların buzul sonrası sığınma bölgelerinden yeniden yayılmalarının -bir başka tabirle, eski bir stoktan yeniden avlanmalarının- bir işareti. Yakındoğu’dan Avrupa’ya Neolitik Dönem boyunca (8000 yıl önceden itibaren) gerçekleşen asıl yakın tarihli göç, belki de modern kolların sadece yüzde 15’ini etkilemiştir.

Güneydoğu Avrupa bölgesinin genetik oluşumu konusunda yakın geçmişteki ilgi çekici bir keşif Romanya’daki Y kromozom izleriyle ilgilidir. Karpat Dağları Buzul Çağı boyunca donmuştur ve böylece güneydoğu Avrupa ve Karadeniz sınırındaki bölgeler arasında etkili, zorlu bir bariyer oluşmuştur. Bu bariyer Romanya’yı yukarıdan aşağı ikiye bölmektedir. Buzları olmadan,Karpatlar’ın bugün aşılmaz bir fiziksel bariyer oluşturduğu pek söylenemez, ama hâlâ keskin bir genetik sınır çizmektedir. Nitekim kuzeydoğu Avrupa ve Ukrayna’nın karakteristik özelliğini taşıyan Y kromozom izleri Karpatlar’ın doğusunda yüksek oranda bulunurken, Karpatlar’ın batısında daha çok orta Avrupa’nın karakteristik özelliği olan işaretçiler bulunmuştur. Ama bu mikro-bölgesel sınır, doğu Avrupa’nın ana Y kolu M17’nin büyük egemenliğiyle karanlıkta kalmıştır. M17, buzulöncesi dönemde Doğu Gravettian kültürünün doğudan girişini karakterize etmektedir. Bu kol, doğu Avrupa’da -Polonya’dan başlayıp,Slovakya ve Macaristan üzerinden Ukrayna’ya kadar- oldukça yüksek bir oranda bulunmuştur. M17 hâlâ Balkanlar’ın Slav halkları arasında yüksek oranda bulunur, bu da Balkanlar’da Buzul Çağı süresince sığınma bölgelerinin bulunduğu savını destekleyebilir.

Bir kez daha kuzey Asya’da, genetik kayıtlar bize anlatıyor ki, sürekli donmuş durumdaki sınırların dayanıklı avcıları, LGM öncesinden kalan eski maternal dallarının bir kısmını korudu ve buzlar çözüldükten sonra bazı altgruplar yayılmaya başladılar. MtDNA kolları A, C ve Z, kuzey Asya’nın karakteristik özelliğidir. D, daha güneye,Çin’e yayılmıştır. Bu kollardan A, birçok M ve N dallarında olduğu gibi, LGM öncesinden bu yana oldukça başarılı bir şekilde hayatta kalabilmiştir. Sonra, D, A, C ve sonunda Z dallarının varyasyonlarının yeniden yayılmasından önce, yani yaklaşık 17.000 yıl öncesine kadar 10.000 yıllık bir boşluk vardı.

Kuzey ve orta Asya’nın genetik yapısı, arkeolojiden bekleyebileceklerimizi doğrulamıştır. Hava soğuduğunda, mamut steplerinin avcıları dizi halinde çekildiler ve hava yeniden ısındığında geri dönüp yeniden yayıldılar. En merak uyandıran soru, dış görünümlerinin, fiziklerinin neye benzedikleri ve bugün en yakın soydaşlarının kim olduklarıdır? Mongoloidler neden ve ne zaman Asya’nın ve Amerika kıtalarının büyük kısmında dominant hale geldiler? Genetik hikâye bize arkeolojik kayıtlardan çıkarılamayacak bir şey anlatıyor mu?
http://www.evrim-teorisi.org/forum/images/misc/progress.gif

dilaver
15-07-2008, 02:05
Dünya çapındaki sığınma bölgeleri

Batıdan doğuya: Moldova, Mezhirich, Afontava Gora, Diuktai, Old Crow ve Bluefish Mağaraları ve The Queen Charlotte Adaları.

Paternal ve maternal genetik soyağaçlarının olağanüstü bölgesel özgüllüklerinin bugün hâlâ devam ediyor oluşu, eski çağlardaki göçlerin izini sürmeyi olanaklı kılar. Bu özellikler sayesinde görüyoruz ki, insanlar Eski Dünya’ya yayılırken, vardıkları yerlerde kalma eğilimindeydiler ve çoğunlukla yeni gelenlerle kaynaşmadan yaşayabildiler. Ancak bu tutuculuğu, son büyük Buzul Çağı büyük ölçüde zedeledi. Kuzey Yarımküre’de, Eski ve Yeni Dünya’nın geniş alanları, buz, buzul göller ve kutup çölleri nedeniyle yaşamaya uygun değildi. Kuzey Avrasya’nın hayatta kalmakta bir hayli başarılı olan önceki avcı-toplayıcılarının, coğrafya ve iklim şartları tarafından belirlenen birkaç seçeneği vardı. Denizler, dağlar ve bozkırla çevrili Avrupa Yarımadası’nda yaşamak için tek seçenek, güney iklim kuşağındaki Akdeniz ve Karadeniz kıyılarına yerleşmekti. Son Buzul Çağı’ndan sonra, sığınmacı grupların pek çoğunun sayıları artmış ve daha geniş bir alana yayılmışlardı; çoğunlukla geldikleri yerlere geri döndüler.

Asya’nın kuzeyi ve ortası otlaklarla çevriliydi ve bu otlaklarda büyük otçul hayvan sürüleri dolaşıyordu. İklimin soğuması ve kuraklık, Üst Palaeotik avcı-toplayıcıları yüksek bozkırlardan çeşitli yönlere doğru, daha sıcak ve ılıman bölgelere gitmeye zorladı. Bu bölgeler arasında, Ukrayna’nın batısı, Çin’in güneyi ve doğusu, Japonya, Kore, kuzeydoğu Sibirya vardı. Asya’nın büyük nehirleri, her zaman olduğu gibi göç yollarını belirlemiş olmalı, ancak trafiğin yönü bu sefer nehir boyunca güneye doğruydu. Son Buzul Çağı’nda bozkırlardaki Üst Palaeotik avcı kültürlerinin Pasifik kıyılarına göçünün arkeolojik kanıtları, başka yerlerde de görülmesine karşın en iyi Japonya’da gözlenir. Deniz seviyesi düştükçe güney ve güneydoğu Asya’da geniş kıta sahanlıkları, yerleşime açıldı. Son Buzul Çağı sırasındaki geniş güneydoğu Asya bölgesindeki nüfus artışının ne kadarının yerli halktan, ne kadarının kuzeyden gelen sığınmacılardan kaynaklandığı net değildir. Ancak genetik ve dental kanıtlar ilkinin ağır bastığını göstermektedir
http://www.evrim-teorisi.org/forum/images/misc/progress.gif

dilaver
15-07-2008, 02:06
Devam eden Genetik Çeşitlilik
19.000 – 15.000 yıl önce

Dünya üzerinde, Toba’dan sonra, modern insanı etkilemiş olan en dramatik iklimsel olay, 18.000 yıl önceki Son Büyük Buzul Çağı (LGM) idi. İronik olan, kuzey Amerika’nın kuzey yarısının kapıları iklim yüzünden kapanırken, buzulun güneyinde, buz koridorunun kapanmasından önce içinden geçen grupların güneye doğru yola devam etmesiydi. Bu gruplar güney Amerika’dan geçerken kültürel ve genetik bir çeşitlenme yaşadı.

Kuzey Yarımküre’deki büyük alanlar buz tabakalarıyla kaplanmıştı ve tropik bölgelerin çoğu savana dönüşmüştü. Aynı zamanda, deniz seviyeleri bugünden çok daha aşağıdaydı,kara parçaları çok daha genişti. Güneydoğu Asya’daki Sunda gibi kıtaya yakın büyüklükte kara parçaları oluşmaktaydı.

Buzul genişledikçe, insan nüfusu az sayıdaki nispeten uygun yaşam alanlarına uyum sağladı. Bütün bir Avrasya kara parçasının kuzeyindeki buzullar ile güneyindeki çöller arasında, Alaska’nın buzullarının oluşturduğu “çıkmaz sokak”tan Fransa’nın güneyine kadar, verimli otlaklar ve stepler oluştu. Bu bölgeler, zengin mevsimlik otlaklarıyla, mamutlar, bizonlar, atlar ve rengeyiklerinden oluşan büyük hayvan sürülerinin beslenmesi için elverişliydi. Bunlar Paleolitik Çağ avcıları için önemli besin kaynaklarıydı.

Boynuz uzunluğu 1,5 metreyi aşan dev bizonlar, “asteroitler” olarak tanımlanan büyük kunduzlar, develer, tembel hayvanlar, erkek Amerikan
geyikleri, iki tür yabani manda, farklı büyüklüklerde ama genellikle aslan boyutunda kediler, mastadonlar ve üç değişik türde mamutlar gibi canlıların yaşamlarını sürdürmek için ihtiyaç duydukları verimli ortamların çoğunun kuzey Amerika’da ortaya çıkmış olduğu sanılmaktadır. Bu hayvanların nesillerinin tükenmesinde (atlar da yok olmuş, ama Kolomb’un izinden giden Avrupalılar tarafından yeniden Yeni Dünya’ya dahil edilmişlerdi), iklimsel ve çevresel değişikliklerin mi, yoksa insan unsurunun mu daha etkili olduğu tartışma konusudur.

Avrasya’nın güneyindeki geniş bölgeye yayılan mamut stepleri, Sahra’nın bazı parçaları, Yakındoğu, Hindistan ve hatta Nil gibi bölgeler, kuraklık yüzünden, nüfusu zorlayacak biçimde neredeyse çoraklaşmaya başlamıştı. Benzer koşullar Avustralya için de geçerliydi. Murray Nehri boyunca bulunan mezarlardaki işaretlerin Nil boyunca keşfedilenlerle koşutluğu bunu göstermektedir.

Afrika için Son Buzul Çağı, diğer bir büyük çöl ve nüfus patlaması anlamına geldi. Avrupa’da ise insanlar, sığınak sayılabilecek güneydeki az sayıda alana (Bask ülkeleri, İtalya ve Balkanlar ile doğu Avrupa’da Ukrayna’ya doğru) çekilmişlerdi. Arkeologlarca ortaya çıkarılan batı ve orta Avrupa’daki nüfus patlaması, genetik bulgularla da desteklenmiştir. Arkeolojinin geleneksel bir açıklaması, Paleolitik avcı-toplayıcılardan arta kalanların yerlerini, geçmiş 10.000 yıl içerisinde Anadolu’daki ve doğu Akdeniz’deki çiftçilerin aldığı şeklindeydi. Buna karşın genetik, en modern Avrupalı paternal ve maternal gen kollarının, zaten Neolitik Dönem’den önce güneydeki sığınaklarla yeniden genişlemiş Avrupa’daki Paleolitik ataların kollarından türediğini ortaya koymuştur.

Son Büyük Buzul Çağ’ın Asya’daki etkileri hakkında çok daha az bilgi bulunmaktadır. Bazı fikirler, daha önceden Yüksek Paleolitik mamut avcılarının yaşadığı engin Orta Asya steplerinin, neredeyse bütünüyle terk edilmiş olduğu yönündedir. Arkeoloji, güney Sibirya’da “büyük donma” yaklaşırken, insan yerleşiminin başladığı en az bir sığınılacak bölge bulunduğunu açığa çıkarmıştır. Hayatta kalan genetik çizgiler bize, hiç olmazsa bazı insanların bu sığınak bölgelerde en kötü soğukları atlattığını söylemektedir.

Bazıları kalmış olsa da, diğerlerinin, hâlâ şansları varken steplerin giderek artan soğuğundan kaçmayı denediklerinden emin olabiliriz. Güneye doğru kaçışın Akdeniz ve Suriye Çölü tarafından sınırlandırıldığı Avrupa’dan farklı olarak, Orta ve kuzey Asya’da daha ılıman iklimlere doğru kaçış için çeşitli uygun rotalar mevcuttu: Batıda doğu Avrupa’ya, kuzeydoğuda Beringia ve Amerika’ya, doğuda Japonya ve Kore’ye, güneydoğuda güney Çin ve güneydoğu Asya’ya olmak üzere birkaç farklı kaçış güzergâhı oluşmuştur. Sonuncusunun en cazip yol olduğu söylenebilir; çünkü diğerlerinden farklı olarak, yaşanabilir alanlar, buzun yayılmasıyla daralmamakta, aksine deniz seviyesinin düşmesi sayesinde artmaktaydı.

dilaver
15-07-2008, 02:07
Kıyıdan Göç mü ?
15.000 – 12.500 yıl önce

İnsanoğlunun kıyıdan göç yolculuğu tezi karşısına çıkarılan bugüne kadarki birincil sav arkeolojik kanıt eksikliğiydi. Beck bir yandan “Yerleşim yerlerine ait veri yok” derken, şunu da ekliyordu: “Tabii ki deniz seviyesinin yükselmiş olması, yerleşim yerlerinin hepsi değilse bile pek çoğunun şu anda sular altında olduğu anlamına gelir.” Özellikle insanlığın erken çağlarındaki denizcilik yeteneği ve kıyı yerleşimlerinin önemi üzerine yazan Erlandson şunları öylüyordu: “Böyle bir şeyin olduğunu henüz kanıtlayamadık. Ama kıta içi yolculuk teorisini destekleyici arkeolojik kanıt da yok. Bu durum o döneme ilişkin bir şanssızlıktır.” Erlandson kıyı yolculuğu tartışmalarına ilişkin şunu da ekledi: “Çok az verinin olması rahatsızlık verici. Ama tam da böyle olması, konuyu özellikle çekici kılıyor.”

“Kesin olan tek şey, Beringia’yı aşan yolculuğun tek bir gruba ait olmadığı, daha karmaşık bir göçün gerçekleşmiş olduğudur” diyen Beck, şunu da ekliyor: “Farklı dönemlerde değişik rotalarda bir göçün gerçekleşmiş olması kuvvetle muhtemeldir.”

İlk mtDNA sonuçları, Amerikalı ve İtalyan genetikbilimciler Douglas Wallace, Antonio Torroni ve çalışma arkadaşlarına, Amerindler’in 20.000 yıl önce ve Alaska’da Na-Dene dilini konuşanların da 6.000-10.000 yıl önce kuzeybatı sahillerine ulaştığını gösterdi. Torroni ve Wallace daha sonra, mtDNA tiplerinin Amerika’nın kolonizasyonu sırasında kıtada var olduğunu gösterdi. Bu çalışma, 24 ayrı etnik gruptan 527 Amerikan yerlisinden, 10 ayrı etnik gruptan 404 Sibiryalı’dan ve 106 doğu Asyalı’dan alınan örnekler üzerinde yapılan yüksek çözünürlüklü analizlere dayanıyor.
http://www.evrim-teorisi.org/forum/images/misc/progress.gif

dilaver
15-07-2008, 02:08
Kuzey Amerika'nın yeniden İstilası
12.500 – 10.000 yıl önce

Amerikan Kutup bölgesi ve Kuzey Kutupaltı’ndaki kolonizasyonları, iki kıtanın geri kalan bölgelerinde yaşayanlarla Asya’dan yapılmış tek bir göç üzerinden ilişkilendirmeye çalışanların karşı karşıya kaldığı bir başka çözülmemiş sorun da, atasal gen gruplarının dağılımındaki dengesizliktir. Atasal grup analizlerinin genel ilkesine ve aynı zamanda evrimin pratik bir kuralına göre, göçün kaynağına ne kadar yaklaşırsanız, ata genlerin tümünü bulmanız o kadar güçlü bir olasılıktır. Bunun aksine, göçün başlangıç noktasından ne kadar uzağa gitmişseniz, çeşitlilik o kadar azalmıştır.

Amerika’da ise tam tersi bir durumla karşı karşıyayız. Amerika’ya göçün başlamış olması gereken yer olan kuzeybatı Alaska’nın yukarısında şu anda, atasal gen kollardan sadece bir tanesi A, A2 tipi şeklinde türemiş olarak bulunmaktadır. Dahası, B ve C ise tüm Kuzey Kutbu ve Kutupaltı boyunca tamamen kaybolmuştur. Bunun tersine, Amerika’nın geri kalanında A ve D atasal grupları çok geniş bir alana yayılmış ve çeşitlenmiş olarak bulunur. Burada bir yanlışlık varmış gibi görünmektedir. Alaska’daki giriş kapısında ve Kanada’nın buraya komşu kesimlerinde bulabildiğimiz şey sadece oldukça genç A2 maternal klanı iken, nasıl olur da, Amerika’da A, B, C ve D’nin tümü yaygın olarak bulunabilir?

Birçok bakımdan, kuzey Amerika’nın güney yarısındaki zengin genetik çeşitlilik, onunla başa baş giden güney Amerika’daki çeşitlilik ve kuzeyin en uç noktasında (Kanada ve Alaska) en alt düzeydeki çeşitlilik, dil sayılarının dağılımının tam tersi bir görüntüyü yansıtır. Eğer ilk-Clovis tezi doğru olsa ve ilk yerleşim Son Büyük Buzul Çağı’ndan sonra meydana gelmiş olsaydı, biz tam tersini bulmuş olurduk. İlkel kolonizasyon Buzul Çağı’ndan önce meydana gelmiş olsaydı, kuzey Amerika’nın geniş parçalarının nüfusu bu çağ boyunca azalmış olurdu. Kuzey Amerika nüfusu “büyük erime” boyunca yeniden genişlemişse, kuzey insanları daha düşük bir çeşitlilik gösterir ve sonuç olarak güneydekilerden daha genç bir devirde varolurlardı.

Altüst olmuş görünen bu tür genetik bulguları açıklayabilecek olan “Buz Çağı’ndan sonra kuzey Amerika’daki genişleme evresi” tezi, 1993’te ileri sürülmüştü. Alaskalı genetik bilimci Gerald Shields ve meslektaşları,
Asya’da ve Amerika’daki Kuzey Kutbu çevresi nüfusunun, genetik olarak daha genç, birbirine benzer ve her iki kıtanın daha uzak güney bölgelerindeki nüfustan farklı olduğunu fark ettiler. Özellikle, B Grubu 55. paralelin kuzeyinde hiç yoktu. Kutup çevresi halklarının, genetik çeşitlilikten yoksun tek bir kuzeyli popülasyonun daha yakın zamanlardaki genişlemesiyle meydana gelmiş olabileceğini savundular. Hatta bu genişlemenin, Amerika’nın daha zengin çeşitliliğe sahip bir popülasyon tarafından kolonize edilmesinden daha sonra gerçekleştiğini ileri sürdüler. Düşük genetik çeşitliliğe sahip popülasyonların Buz Çağı’ndan ve Amerika’nın önceki kolonizasyonundan sonra Kanada ve Alaska’daki genişlemesini ileri süren bu görüşün, bu bölgeler tarafından ortaya sürülen çözülmesi zor genetik ve dilbilimsel sorulara cevap olabilmesi için daha uzun bir yol katetmesi gerekiyor gibiydi.

Bu yeniden genişleyen uzak kuzey gruplarının nereden geldiği -Asya’dan mı Amerika’dan mı- sorusu hâlâ ortada duruyordu. Sibiryalı Inuit ve Chukchi’deki A2 varlığı olası bir Asyalı kaynağı ileri sürerken, A1 / A2 bağına işaret eden yeni genetik kanıt Amerika’yı işaret ediyor gibiydi. Yine de, bütün diğer Amerikalılar’ın olduğu gibi, eğer Na-Dene ve Inuit-Aleut de aynı orijinal genetik depodan geliyorsa, bu çağdaki bu denli büyük farklılık ve genetik, fiziksel ve dilsel olarak bu kadar derin bir ayrım, nereden geliyordu?

1996’da, Anglo-Alman genetikçi Peter Forster ve uluslararası bir ekip, bu problem yumağını tutarlı bir açıklamaya kavuşturmak yönünde ilerlediler. Bu, birçok insanın uzunca bir zamandır çözmeye uğraştığı bir satranç problemi gibiydi. Ama yanıt basitti. Forster’ın birlikte çalıştığı insanların arasında, Antonio Torroni ve bir matematikçi ve çok yönlü bir bilimci, aynı zamanda bu harita için kullandığım gerçek gen ağaçlarını yaratmakta gerekli olan analizin çoğunun yaratıcısı ve ilham kaynağı olan Alman Hans-Jurgen Bandelt vardı. Amerika bilmecesinin yanıtı, kuzeyli insanların Buz Çağı’ndaki yurtlarının Asya ya da Amerika değil, başka bir kıta, Beringia olduğu idi.

11.000 ila 25.000 yıl önce, deniz seviyesi o kadar düşüktü ki, Bering Boğazı, Asya ve kuzey Amerika arasında karadan bir köprü durumundaydı. Gerçekte, Beringia bir köprü olmaktan daha fazlasıydı; en geniş uzamıyla 1,3 milyon km2’lik (500 bin mil2) başlı başına büyük bir kıtaydı. Buzla kaplı değildi, dahası tundra otlaklarıyla otçul memeli hayvan sürüleri
için elverişli bir bölgeydi. Yazlar şimdikinden kesinlikle daha serindi,
ama aksine kışlar daha ılıman ve yumuşaktı. Kara köprüsünün varlığını
sürdürdüğü dönemin büyük bölümünde, daha güneyde sürekli olarak
buz tepeleri vardı ve 15.000 ila 20.000 yıl önce aradaki buz koridoru,
muhtemelen Amerika’nın kuzeyi ve geri kalanı ile arasındaki bağlantıyı
engelleyecek şekilde kapalıydı. Sibirya çevresi, o dönemde bir kutup çölü olan kuzey Amerika’dan daha çekici sayılmazdı. Böylece Beringia ve Alaska’nın batı kesimleri, her iki kıtadan da ayrı olarak, fiilen bir Buz Çağı sığınağı haline geldi. Amerika’ya ilk yerleşenlerin özgün genetik yapısından arta kalanları barındıran Beringia sığınağı sayesinde, şimdi, A1 / A2 grubu gen ağacı üzerinden Amerika’yla bağlantısı olan Na-Dene ve Inuit-Aleut’un, neden yoksul çeşitlilikleriyle Amerikalılar’ın geri kalanından epeyce farklı göründüğünü görebiliriz.

dilaver
15-07-2008, 02:09
Yolculugun Sonuna Dogru
10.000 – 8.000 yıl önce

10.000 yıl önce, Son Buzul Çağı’nın (LGM) sonunda, insan nüfusu sadece
birkaç milyondu ve bütün besinlerini vahşi bitki ve hayvanlardan elde ediyordu. Daha sonra insanlar, bu türlerin bazılarını evcilleştirmeye başladı. Öyle ki, bugün dünya nüfusunun besinlerinin neredeyse tamamı, evcilleştirilmiş olan görece daha az çeşitteki ekinlere ve evcil hayvanlara dayalıdır. Tarım Devrimi’ni önceleyen 150.000 yıl boyunca anatomik olarak modern insanlar dünyanın neredeyse tamamını yayıldılar ve büyük bir hayvan ve bitki çeşitliliğini içeren besinlerle geçinen avcı-toplayıcılar olarak hayatta kalmayı öğrendiler. Toplayıcılar yiyecek kaynaklarına erişebilmek için mevsimsel olarak göç eden küçük gruplar halinde yaşıyordu ve nüfus yoğunlukları bin yıllar boyunca düşük kaldı.


Toplayıcılıktan çiftçiliğe

MÖ 8000’e gelinirken, bazı avcı-toplayıcı grupları yerleşik hayata geçti ve yıllar geçtikçe uygun bölgelerde yerleşmeye başladı. Üreme üzerinde mevsimsel hareketliliğin zorladığı kısıtlamalar kalktığından, nüfusları arttı. İnsan davranışındaki bu temel değişiklik, tarımın başlangıcına ve ekin yetiştirmek ve evcil hayvan beslemek için daha fazla çaba sarf etme pahasına da olsa, aynı toprak parçasının daha fazla insanın ihtiyacını karşılamaya başlamasına önayak oldu. Yerleşik hayata geçiş, nüfus artışı ve tarıma dayalılık, yerleşimlerin sayı ve büyüklüklerinin artmasına, daha kompleks ve daha az eşitlikçi toplumlara ve en sonunda şehir yaşamı ve uygarlığına dönüşümün yolunu açtı.

Tarımın en erken kanıtlarını, morfolojisi veya davranışı insan müdahalesiyle
değiştirilmiş vahşi türlerin izleri oluşturur. İlk ekin örneklerini, tohumları karbonhidrat ve kısmen protein kaynağı olan ve kolayca depolanabilen
tahıllar ve baklagiller (bezelye, fasulye vs.) oluşturur. Bu ürünler ilk uygarlıkları ayakta tutmuş ve dünya tarımının başlıca mahsulleri haline gelmişlerdir. Bu bitkiler, subtropikal bölgelerdeki vahşi çayırlardan evcilleştirilmişlerdi. Örneğin buğday, arpa, mercimek, bezelye ve nohut güneybatı Asya’da; pirinç ve soya fasulyesi güney ve doğu Asya’da; süpürge darısı ve diğer darılar ile börülce Tropikal Afrika’da; mısır ve fasulye de Meksika’da evcilleştirilmiştir. Kök bitkiler de, birçok bölgede başlıca ürün haline gelmiştir. Örneğin And Dağları’nda evcilleştirilen ve bugün ılıman bölgelerdeki başlıca ürün olan patates ve anavatanı tropik bölgeler olan manyok, yerelması ve tatlı patates gibi.


Hayvanların evcilleştirilmesi

Tahılların ve kök bitkilerin kültür tarımına başlanması ve evcilleştirilmesi,
Avustralya dışındaki -burada tarım 18. yüzyılda Avrupalı yerleşimciler
tarafından başlatılmıştır- tüm yerleşilebilir alanlarda gerçekleşirken,hayvanlar göreceli olarak daha sınırlı alanlarda evcilleştirilmiştir. Esas olarak batı Asya’da koyun, keçi, domuz ve sığırın ve daha sonra eşek, at ve devenin erken evcilleştirilmesi üzerine kanıtlar bulunmuştur. Güney ve doğu Asya’da da bazı sığır türleri ile domuz ve tavuk evcilleştirilmiştir. Sığır ve domuz, bağımsız olarak Avrupa’da da evcilleştirilmiş olabilir. Amerika kıtasında çok az sayıda hayvan evcilleştirilmiştir: kuzey Amerika’da hindi, güney Amerika’da ise lama, alpaka ve Hint domuzu evcilleştirilmiş; Tropikal Afrika’da veya Avustralya’da evcilleştirilen hayvan olmamıştır.

Çiftçiliğin yayılması

Arkeolojik kanıtların gösterdiğine göre, en erken tarıma geçiş Neolitik Dönem’de MÖ 8000’den başlayarak güneybatı Asya’daki Bereketli Hilal Bölgesi’nde gerçekleşmiştir. Doğu Akdeniz’deki kazı alanlarında kömürleşmiş arpa tohumu ve kabuklarına; buğday ve çeşitli baklagillere ve bunun yanı sıra evcilleştirilmiş koyun ve keçi kemiklerine rastlanmıştır. Radyokarbon tarihlemesine göre, burada kültür tarımı koyun çobanlığından 1.000 yıl önce başlamıştır. Tarıma bağlılık, köy yerleşimlerinin yaygınlaşması, sulama ve teraslama tekniklerinin gelişimi, hurma, incir, üzüm ve zeytin tarımına başlanmasına paralel olarak, kademeli bir şekilde gerçekleşmiştir. Güneybatı Asya’da Neolitik Dönem’in bitiminde, yaklaşık 6000 yıl önce, tarım Avrupa, kuzey Afrika, orta ve güney Asya’ya yayılırken ekinlerin artan çeşitliliğine yeni evcilleştirmeler ekleniyordu.

Çin’de tarım bağımsız olarak MÖ 7000 ile 6000 arasında, Amerika Kıtası’nda MÖ 3000 civarında ve Tropikal Afrika’da MÖ 2000 civarında başlamıştır. MS 16. yüzyıldaki Avrupa yayılması başladığında Avrasya, Afrika ve orta-güney Amerika’nın tamamında tarım ve hayvancılığa dayalı ekonomiler egemen durumdaydı.
http://www.evrim-teorisi.org/forum/images/misc/progress.gif

dilaver
15-07-2008, 02:09
Son 10.000 yılda tarım ve teknolojideki gelişmeler

10.000 yıl önce Bitki evcilleştirilmesinin ilk kanıtı.

9000 yıl önce Türkiye ve Suriye’de keten, giyim ve yağ elde etmek için kullanıldı.

8000 yıl önce Doğu Akdeniz’de fasulye kullanıldı.

7000 yıl önce Amerika Kıtası’nda mısır, kabak, fasulye ve biber kullanıldı.

6000 yıl önce Pakistan’da pamuk yetiştirildi, Afganistan’da kültür üzümüne rastlandı.

5000 yıl önce Çin’de soya fasulyesi, pirinç, buğday ve arpa kullanıldı.

4000 yıl önce Doğu Akdeniz’de zeytin, şeftali ve kayısı yetiştirildi.

3000 yıl önce Fenikeliler Akdeniz’de, Polinezyalılar Pasifik’te yelken açtılar.

2000 yıl önce Denizciler Muson rüzgârlarını kendi lehlerine kullanabileceklerini keşfettiler.

1000 yıl önce Yeryüzünde Homo sapiens’in sayısı 254-345 milyona ulaştı.

Günümüzde Dünya nüfusu tahmini 6.4 milyara ulaştı.

dilaver
15-07-2008, 02:10
Avcılıktan çiftçiliğe: Örnek olay incelemesi; güneydoğu Asya

Son Buzul Çağı’nın bitimiyle birlikte karaları kaplayan buz tabakasının erimesi, Güneydoğu Asya’daki yaşam tarzını ve coğrafyayı değiştirdi. Yükselen deniz seviyesi kıyı şeridinin karaya oranını üç kat artırarak, güneydoğu Asya Anakarası’nı batı Endonezya Adaları’na bağlayan Sunda Sahanlığı’nı batırdı ve birçok yeni ada ve haliç oluşturdu. Sıcaklıklardaki artış aynı zamanda
daha geniş bir bitki çeşitliliği ve yoğunluğunun ortaya çıkmasına neden oldu. Bütün bu değişiklikler avcı-toplayıcı toplulukları için kısmen yararlı olmuştur,
çünkü kıyılar ve haliçler zengin bir yiyecek kaynağı özelliği gösteriyorlardı. Bu döneme ait taş alet buluntularının çoğu da kıyılar ve haliçlerdeki kabuk istiflerinden çıkarılmıştır.

Diğer elverişli yaşam alanları da Burma’dan Vietnam’a ve güneyde Endonezya’ya uzanan, kendine özgü kireçtaşı dolomit formasyonlarında bulunan mağara ve kaya barınaklarıydı. Bu barınaklarda çoğunlukla Buzul
Çağı sonrası dönemin başlangıcına kadar tarihlenebilen uzun süreli insan yerleşimine ilişkin izler açığa çıkmaktadır. Örneğin kuzey Vietnam’daki Tham Hoi ve Burma’daki Padah-lin’e ilk olarak 12.000 yıl önce yerleşilmiştir. Güneydoğu Asya’da bu dönemden en sık rastlanılan kalıntılar taş aletlerdir. Aletler iki ayrı geniş geleneğe ait özellikler göstermektedir: Anakaraya ait Hoabinhian ve adalara ait modern yontma geleneği.

Hoabinhian (Hoabinhyen) adı Tonking’in Hoa Binh bölgesindeki kireçtaşı mağaralarında bulunan yontulmuş çakıl taşı aletlerden gelmektedir. Benzer aletlere güneydoğu Asya boyunca Burma, Tayland, Laos, Kamboçya,
Vietnam, Malaya ve kuzey Sumatra’da da rastlanmıştır. Bunların neredeyse tamamı, bir veya iki yüzü üzerinde çalışılmış veya küçük baltalar yapmak için kesilmiş olan ve nehir tarafından aşındırılmış volkanik kaya kaynaklı çakıl taşlarından yapılmıştı. Aynı zamanda bazı aletlerin de kabuk ya da kemiklerden yapıldığı gözlenmiştir.

Güneydoğu Asya’daki en erken ada işi rendelenmiş taş aletler, Endonezya, Borneo ve Filipinler kaynaklıdır ve en az 40.000 yaşındadır. Ada işi aletler sıklıkla kuvarstan yapılmıştır, ancak Filipinler, batı Java ve güney Sumatra’da obsidyen aletler de bulunmuştur. Kuvars aletlerde zaman zaman, prehistorik mağara sakinlerinin, palmiye gibi, aletlerin kenarları üzerinde çıkmayan bir cila bırakan silis açısından zengin bitkilerle çalıştıklarını düşündürten cila veya parlaklık izine rastlanmıştır. Bu izler üzerinde yapılan çalışmalar, olasılıkla sepet, ip ve hasır yapmak amacıyla hintkamışı ve pandanus yaprağını da içeren bir çeşitlilikte bitkilerin kullanıldığını göstermektedir.

Bu dönemdeki birçok yerleşmeden önemli hayvan ve bitki kalıntıları elde edilmiştir. Kuzey Tayland’daki Spirit Mağarası’nda bulunan bitki kalıntıları bugün de ekilen bazı bitkilere ait olarak tanımlanmıştır; ancak evcilleştirilmiş
türleri vahşi türlerden ayırt etmek çok zordur ve eldeki az miktardaki tohum kalıntısına dayanarak bir çiftçilik etkinlikleri düzeni oluşturmak da mümkün değildir. Timor ve Celebes’de bulunan kömürleşmiş tohumlar,Piper, Arecea (arecea cevizi sakızının iki ana içeriği), Canarium, Prunus, Aleurities (kabuklu yemiş veren ağaçlar) ve Lagenaria (sukabağı) gibi bitkilerin 5.000 yıl önce de kullanılmakta olduğunu göstermektedir.Korunmuş olan bu kalıntıların çoğu ilaç ya da zehir özelliği olan bitkiler ve ağaç meyveleridir. Kökler ve hububat gibi temel yiyeceklere ilişkin az kalıntı vardır.

Kanıtların belirsizliğine rağmen, güneydoğu Asya’da tarıma geçişin, toplulukların toplayıcılık ve avcılığa destekleyici olarak birkaç bitki türünü dikme ve hasadını yapmaya başlamalarıyla gelişen kademeli bir süreç olması muhtemeldir. Anakarada MÖ 6.000 civarında ve adalarda MÖ 2.500 yılında başlayan çömlekçilik, güneydoğu Asya boyunca belirgin bir değişikliği işaret etmektedir. Anakara yerleşmelerinde, bu zamana ait seramikler, dört köşeli keserler ve cilalanmış arduvaz bıçaklar bulunurken, adalarda sert, kırmızı-cilalı çömleklerin yapılmaya başlanması evcilleştirilmiş egzotik hayvanların gelişine tesadüf etmektedir. Kırılgan bir malzeme olarak çömlek, göçebe avcı-toplayıcı topluluklar tarafından nadir olarak üretilmekteydi. Bu yüzden ortaya çıkışı, olasılıkla sabit yerleşimlerin giderek artmasıyla aynı zamana denk gelmektedir.

Bu dönemde topluluklar arası ilişkilerde bir artış ve ticaret ağlarında genişleme de görülmektedir. Artan ilişkilerin, ekonomik temelin farklılaşmasıyla birleşimi -avcı toplayıcılığın basit tarımla desteklenmesi-, artan bir karmaşıklaşmaya işaret etmektedir ki; bu süreç MÖ 3. binyılın sonunda bronz teknolojisinin geliştirilmesiyle sonuçlanacaktır.
http://www.evrim-teorisi.org/forum/images/misc/progress.gif

dilaver
15-07-2008, 02:13
Bu dosyanın kaynagı www.bradshawfoundation.com/journey (http://www.bradshawfoundation.com/journey), Burada güzel illustrasyonları da var.

Aslında evrim sitesinde yayınlanması gerekiyordsu bu dosyanın, ama teknik bir sorun yüzünden bir süredir oraya yazı asamıyordukç

Ben de bu dosyayı nereden gelip nereye gittigimiz merak eden tüm arkadaşların ilgisine sunmak için sitemize aldım.

saygılarımla

AKHENATON
29-09-2008, 15:30
Dünya üzerinde bulunan iki farklı yaratılış teorisine göre , insanoğlunun kökeni ile ilgili düşünceler oldukça farklıdır.Farklı iki teori yüzyıllardır birbiriyle savaş halinde olup bugüne
kadar kesin bir galibi olmamakla birlikte kavganın süreceğini ve iki farklı teorininde birbirine karşı üstünlük sağlayamayacağı şimdiden bellidir.

Deistler ve Ateist'ler arasındaki bu yaratılış kavgaları asla sonuçlanamaz.Sebebi ise iki karşıt düşünceninde doğruyu göstermediğidir.İki yanlıştan bir doğru çıkmaz.

Farklı 2 düşünceye mensup insanlar , aslında aynı şeyi savunduklarını sadece tribünden inip tarafsız oldukları zaman anlayacaklardır.Gerek Teizm gerekse Ateizm , dünyanın belirli bir noktasında oluşturulan düşünce sistematiği içerisindeki karşıt iki düşünce olup teze-anti tez ile insanoğlunun geçmişini vermekten çok birbirlerini doğrulamaktan öteye geçemezler.Konuyla ilgili modern dünyada nasıl Dawkins moneist dinleri doğruluyorsa, ülkemizdede harun yahya ateizmi doğrular.Tek yaptıkları insanı bir çizgide farklı 2 düşünce kutbunda tutmaktan öteye geçemez.İkisine görede insan düşünemez, sadece taraf olur.

Yaratılışla ilgili olarak farklı 2 teori ;

1- Yaratılış
2- Darvinci yaklaşım.

Sayın dilaverin başlığı altında bu iki konu hakkında sadece gerçekleri yazıcam.Farklı bir başlık halinde yazmak isterdim fakat başlık açma yetkim yok.

Öncelikle din kitaplarındaki insanın yaşını tek yazı halinde verip geçicem.Daha sonra Ateistlerin bilim adı altında savundukları Darwin yaklaşımını ve sayın dilaverin yukarıda vermiş olduğu yazının tamamen doğmatik olduğunu somut arkeolojik ve biyolojik kanıtlarıyla ortaya koyucam.

Sayın dilaverin yukarıda vermiş olduğu yaklaşım Havva Teorisi olup havva teorisi yayınlanana kadar bilim tarafından savunulan ve insan gerçeği olarak lanse edilen bir çok bilgi görmezden gelinerek veya saklanarak oluşturulan Gerçek Darwin yaklaşımına yazıcam. Aslında bu iki yaklaşımda dNA çözümlemeleriyle birlikte dünya bilim çevrelerinde bitmiştir.Konuyla ilgili Sciencede bir çok yazı ve makale bulunmaktadır.Özellikle dNA ile yazacaklarımdan sonra Ateist arkadaşlar hala Darwini savunuyorlarsa bu işin artık politik bir malzeme olduğu kimsenin gerçeği aramadığının bir kanıtı olduğunu herkes görecek.

Not . Umarım yazılarımı yönetim yayınlar.

AKHENATON
29-09-2008, 21:37
Evet Teorilerden yaratılışı çok kısa yazalım ve darvine geçelim.

Yahudilere Göre __________________________________________________ ________
Olaylar.(DünYa Tarihi)........Ussher'e göre tarih.......Hales'e göre Tarih
__________________________________________________ _______
Yaratılış..................................4004... ..........................5411
Nuh'un doğumu........................2948................ .............3755
Tufan.....................................2348.... .........................3155
İbrahimin doğumu.....................1996................... ..........2153
Yakup'un doğumu.....................1836................... ...........1993
Yusuf Köle olarak satılması.........1728............................ ..1885
Yusufun vezirliği.......................1715.............. ................1872
Yusuf'un ölümü........................1635................. .............1792

Görüldüğü üzere yaratılış teorisi hiçbir bulgu ile uyuşmadığından doğrudan üstünü çizebilirz. İbrahimi dinlerde insanın yaşı max.5500 yıllıktır.

Yaratılış ve insanın yaşı ile müslüman dünyasında dolanan hadislere bakarsak ;



Peygamberimiz “Ben insanlığın ikindi vaktinde geldim.” buyuruyor. Diğer bir hadisinde ise “Benim ümmetimin ömrü 1500 seneyi pek geçmeyecek.” buyurmuş. Günün dörtte ya da beşte biri olan ikindiden akşama kadar ki vakti 1500 yıl kabul ettiğimizde, insanlığın ömrünün 6000 - 7500 yıl arasında olduğu ortaya çıkar. Diğer bir meşhur hadis rivayetinde ise bu açıkça ortaya konmuştur: “Adem'den kıyamete kadar insanlığın ömrü yedi bin senedir.” Görüldüğü gibi bu üç hadis birbirini teyit etmekte ve tamamlamaktadır. Muhbir-i Sadık olan Peygamberimizin (s.a.v.) ahirzamanla ilgili verdiği haberler bir bir çıkmaktadır.


Görüldüğü üzere hem yahudilikte hemde müslümanlıkta yaratılışla ilgili insanı düşünmeye itebilecek her hangi bir yaklaşım bulunmaz.

AKHENATON
29-09-2008, 23:14
Modern bilimin insanın köklerine ilişkin savunduğu düşünce arkeoloji ve antropoloji cephesinde engellenemez şekilde bilgi akışı gerçekleştiği için Evrim Teorisi 1987 yılında değiştirilmiştir.

Bilim dünyasının 1987 yılına kadar savunmuş olduğu teori klasik darwinci yaklaşım, 1987 yılından sonra ise mtaDNA yaklaşımıdır.

Klasik darwin çok merkezli teorisinde Cro-Magnan adamı’nın yaşı 35.000 yıldır, dünya üzerinde çok farklı bölgelerde birden bire ortaya çıkan bu gizemli canlıyla ilgili hergün bulunan arkeolojik kanıtlar ve ortaya çıkışın açıklanamaması , sapiense geçişte akrabanın olması fakat atanın bulunamaması ve çok merkezin gerçeğe uymaması nedeniyle gözden düşmüş ve bilim dünyası ikiye bölünmüştür.

Bir kısım bilim adamları yeni bulguları görmezden gelerek hala bu teoriye sıkı sıkıya sarılmışken , bazı bilim adamları ise 1987 tarihli Mitokondriyal DNA yaklaşımına savunarak , gerçeği söylemek yerine yanlışa yeni bir yanlışı eklemişlerdir.Bu yaklaşıma göre 200 bin yıl önce afrikada yaşayan Havva teorinin çekirdeğini oluşturur.

Bu iki evrim teorisinin birbirlerinden farkı sapiensin yaşıyla ilgili birbirleriyle olan oldukça uzak düşünceleri olmakla beraber, iki düşüncenin kırılma ve teorilerin gülümseten noktası ise ikisininde Amerika kıtasını açıklayamamasıdır.

Bilim dünyası her gün mevcut tarihlerle oynayarak, bulguların ötesinde dünyaya ve insana tarih yazmakla meşgul iken mevcut teorin anlatımları içerisinde bilgiler o kadar iç içe geçmiştirki , DNA yaklaşımını savunan düşünce elinde arkeolojik ve antropolojik desteği olmaması nedeniyle Klasik Teorinin Sapiensin uygarlık mücadelesi anlatımına sıkı sıkıya sarılmıştır.

Diğer taraftan insan DNA sının günümüz koşullarında çözülmüş olması evrimle ilgili bu iki teorinin artık gülümseten bir anı olarak hafızalarımızda saklayacağımız bir anı olarak kalmasına sebep olmuştur.

Not : Teori , arkeoloji ve antropoloji olarak devam edecek. Aynı zamanda İnsan DNA sına dair yazacaklarım sapiensin evrim olduğu teorisini bitirecektir.


Devam Edecek.

dilaver
30-09-2008, 00:55
Akhenaton, hiç bir biçimde başlıgı okumadan yazdıgına eminim :

11.000 ila 25.000 yıl önce, deniz seviyesi o kadar düşüktü ki, Bering Boğazı, Asya ve kuzey Amerika arasında karadan bir köprü durumundaydı. Gerçekte, Beringia bir köprü olmaktan daha fazlasıydı; en geniş uzamıyla 1,3 milyon km2’lik (500 bin mil2) başlı başına büyük bir kıtaydı. Buzla kaplı değildi, dahası tundra otlaklarıyla otçul memeli hayvan sürüleri
için elverişli bir bölgeydi. Yazlar şimdikinden kesinlikle daha serindi,
ama aksine kışlar daha ılıman ve yumuşaktı. Kara köprüsünün varlığını
sürdürdüğü dönemin büyük bölümünde, daha güneyde sürekli olarak
buz tepeleri vardı ve 15.000 ila 20.000 yıl önce aradaki buz koridoru,
muhtemelen Amerika’nın kuzeyi ve geri kalanı ile arasındaki bağlantıyı
engelleyecek şekilde kapalıydı. Sibirya çevresi, o dönemde bir kutup çölü olan kuzey Amerika’dan daha çekici sayılmazdı. Böylece Beringia ve Alaska’nın batı kesimleri, her iki kıtadan da ayrı olarak, fiilen bir Buz Çağı sığınağı haline geldi. Amerika’ya ilk yerleşenlerin özgün genetik yapısından arta kalanları barındıran Beringia sığınağı sayesinde, şimdi, A1 / A2 grubu gen ağacı üzerinden Amerika’yla bağlantısı olan Na-Dene ve Inuit-Aleut’un, neden yoksul çeşitlilikleriyle Amerikalılar’ın geri kalanından epeyce farklı göründüğünü görebiliriz.

AKHENATON
30-09-2008, 01:07
Akhenaton, hiç bir biçimde başlıgı okumadan yazdıgına eminim :

11.000 ila 25.000 yıl önce, deniz seviyesi o kadar düşüktü ki, Bering Boğazı, Asya ve kuzey Amerika arasında karadan bir köprü durumundaydı. Gerçekte, Beringia bir köprü olmaktan daha fazlasıydı; en geniş uzamıyla 1,3 milyon km2’lik (500 bin mil2) başlı başına büyük bir kıtaydı. Buzla kaplı değildi, dahası tundra otlaklarıyla otçul memeli hayvan sürüleri
için elverişli bir bölgeydi. Yazlar şimdikinden kesinlikle daha serindi,
ama aksine kışlar daha ılıman ve yumuşaktı. Kara köprüsünün varlığını
sürdürdüğü dönemin büyük bölümünde, daha güneyde sürekli olarak
buz tepeleri vardı ve 15.000 ila 20.000 yıl önce aradaki buz koridoru,
muhtemelen Amerika’nın kuzeyi ve geri kalanı ile arasındaki bağlantıyı
engelleyecek şekilde kapalıydı. Sibirya çevresi, o dönemde bir kutup çölü olan kuzey Amerika’dan daha çekici sayılmazdı. Böylece Beringia ve Alaska’nın batı kesimleri, her iki kıtadan da ayrı olarak, fiilen bir Buz Çağı sığınağı haline geldi. Amerika’ya ilk yerleşenlerin özgün genetik yapısından arta kalanları barındıran Beringia sığınağı sayesinde, şimdi, A1 / A2 grubu gen ağacı üzerinden Amerika’yla bağlantısı olan Na-Dene ve Inuit-Aleut’un, neden yoksul çeşitlilikleriyle Amerikalılar’ın geri kalanından epeyce farklı göründüğünü görebiliriz.


sayın dilaver öncelikle acele etmeyiniz daha yeni başladım ve evrim teorisi tanımlaması yaptım.

bakınız yazınızı okumadan yazdığımı yazmışsınız , yazınızı çektim ve toplam 40 sayfaya böldüm.Ve yazınızın her yerinin gerçek kanıtlarını ortaya koyarım. Yazınız şuanki mevcut DNA yapısı üzerine Gordon Childe yaklaşımından başka bir şey değil.Yanlız gerçekle asla uyuşmaz ve yazdığım müddetçe göreceksiniz.

Bering geçisini yazmışsınız bunları çürütmem oldukça kolay.Lütfen bekleyiniz. Zaten yazmış olduğunuz yazı kendi içinde çelişkili , bu çelişkiyi yazımda okuyacaksınız, tek yapmanız gereken sabırlı olmak.

Size bering geçişiyle ilgili tüm arkeolojik ve antropolojik bilgiyi vericem.Ve daha sonrasında bu teorinizi devam ettirecekmisiniz merak etmekteyim.

Benim amacım gerçeği bulmak sizinkinin ne olduğunu , sizin teorinizi ve gerçekleri yazdığım zaman anlayacaz.

Bakınız başta yazmış olduğum 2 tane teoriyi ve zaman içindeki değişimini görmezden gelmiş hemen bering e sarılmışsınız.Ama oda bitecek.Endişe etmeyiniz.

Beringten sonra DNA üzerine Sciencede çıkan yazıyı yazdığım zaman zaten film kopmuş olacak.

Not : Foruma yeni üye olanlar beni sakın dinci falan sanmısın, evrimi eleştirenler genelde teist olarak adlandırıldığı için kavram kargaşası yaşamayalım. Savunduğum düşünce " Müdahaleli Evrimdir." (Nasıl ismi iyi koymuşmuyum.:D)

AKHENATON
30-09-2008, 15:26
Evet yazımıza devam edersek ,

Öncelikle sayın dilaverin bering geçişini henüz yazmadım.Yukarıda yazmış olduğum yazılar Mutlak doğru olarak Sapiensin Evrimiyle ilgili tartışılmaz dahi diyerek insanoğlunun önüne süren Bilim Olimposunun süreç içindeki görüş değişikliğini yazdım.Çok merkezli evrimden tek merkezli evrim teorisine geçmesi.İkisininde ortak ve en somut çıkmazının , arkeoloji ve antropoloji cephesinden batkımız zaman Amerika kıtası olduğunu belirttim fakat henüz açmadım.

Evet şimdi klasik Darwin çok merkezli evrim teorisinin yıkılma sebepleri ve bir kısım bilim adamları tarafından yerine ikame ettirilmeye çalışılan mtaDNA (Havva) teorisine geçişi kısaca anlatalım.

Klasik çok merkezli Darwin teorisinde Cro-Magnan adamının yaşı 35.000 yıldır. Antropoloji ve arkeoloji cephesinde bu tezi çürütecek bulgular 20 yy. başlarından itibaren engellenemeyecek hızla artmasıyla birlirte bilim dünyası oldukça sıkıntıya girmiştir.

İlk önce Niede Guidon ve Georgette Delibrias’ın 1986 yılında brezilyada yaptıkları araştırmalar ile Ortodoksin Teori sallanmaya başlamıştır.2 araştırmacının bulgularına göre Amerika kıtasında insanın yaşı 35.000 yılı öncesine kadar gitmektedir.

Bilim rahiplerince yönetilen , üniversite oligarşisi başlangıçta bu tezlere oldukça sert tepki vermiştir.Ne vardi yapılan Karbon-14 testleri tezleri doğrulayınca oligarşik bilimin söylecek fazla bir şeyi kalmamıştır.

Ardından kıtada yapılan araştırmalarda Amerikada insan varlığını 70.000 yıl önceye ,Wisconsin buzul dönemine dayandıran sonuçlar ortaya çıkmıştır.

Cro-Magnan adamın yaşının 35.000 yıl olduğuna göre , Wiskonsinde 70.000 yıl önce yaşayan bu insan ırkı kimdir. ?

Wiskonsin kalıntıları ile Bering “ Göçü teorisi “ kumdan kale gibi yıkılmıştır.

Bir Neanderthal göçü gibi radikal bir yaklaşım düşünülebilirmiydi. ?

Eğerki Bering geçişini doğru saysak bile ; Beringten gelen Asyalılar Kuzey Amerika yerlilerini oluşturuyorsa , Orta ve Güneyde yaşayan kimlerdir. ?

Tüm bu gelişmeler ışığında teorilerine sıkı sıkıya sarılmış Küresel Bilim dünyası , İnsanoğlunun önüne yeni teori ve düşünce yapısı koymaktansa yanlışa bir yanlışla daha cevap vermiştir.

Ocak 1987 de Allan Wilson ve Kalifornia Üniv. , Berkeleyden Meslektaşı Rebecca Cann ve Mark Stoneking , NATURE dergisinde “ Mitokondriyal DNA ve İnsanın evrimi “ isimli bir makale yayımlarlar.

Bu biokimyacılara göre insanın yaşı 200.000 bin yıl önce Afrikada yaşamış bir dişi bireye kadar izlenir.
Bu yaklaşım eski ahite bir gönderme olarak bilim dünyasında “ Mitekondriyal Havva “ olarak adlandırılan yeni bir teorinin çekirdeğini oluşturur.

Yalnızca anatomik anlamda değil, davranışsal olarakta insanın geçmişini izlemeye çalısır.Ve çok merkezli teoriye karşın insanın yaşını daha geriye attığı için üstün duruma geçer.Çok merkzli teori ; farklı coğrafi bölgelerde aynı zamanda evrimi savunan teori arkeolojik bulgular ile artık çökmüştür.

MtaDNA yaklaşımının günümüz koşullarında DNA yapısını gösterdiği, geçmişe ayna tutmasının imkansız olduğunu ve teorinin geçersizliğini önümüzdeki yazılarda yazıcam.





Devam edecek ; gelecek yazı detaylı Bering ve Amerika.

dilaver
30-09-2008, 21:54
Wiskonsinde 70.000 yıl önce yaşayan bu insan ırkı

Bununla ilgili verileri , bulguları, kanıtları alabilmek mümkün mü.

saygılarımla

AKHENATON
30-09-2008, 23:24
Wiskonsinde 70.000 yıl önce yaşayan bu insan ırkı

Bununla ilgili verileri , bulguları, kanıtları alabilmek mümkün mü.

saygılarımla

Tabiki sayın dilaver ; konuda oldukça detaya giricem. Ayrıca amerikada üniversitelerde okutulması yasaklanan arkeoloji kitabını kaynakça olarak yazımda belirtirim.

evrensel-insan
01-10-2008, 01:50
Saygideger dilaver ve AKHENATON;

Bilgilerinize, yardimci olacagini dusundugum bir linki asagida veriyorum. Ta "big bang" dan, baslayip; tarih oncesini ve sonrasi medeniyeti tarihsel bir kronoloji temelinde veriyor. Ustelik, tum peygamberlerin de tarihlerini iceriyor. Verilen, bilgilerin ne kadar guvenilir olup olmadigini; sizler, inceleyince karar verirsiniz. Yalniz, link ingilizce.

http://www.b17.com/family/lwp/chronology/prehistory.html

Saygilarimla;
evrensel-insan

AKHENATON
01-10-2008, 03:09
Saygideger dilaver ve AKHENATON;

Bilgilerinize, yardimci olacagini dusundugum bir linki asagida veriyorum. Ta "big bang" dan, baslayip; tarih oncesini ve sonrasi medeniyeti tarihsel bir kronoloji temelinde veriyor. Ustelik, tum peygamberlerin de tarihlerini iceriyor. Verilen, bilgilerin ne kadar guvenilir olup olmadigini; sizler, inceleyince karar verirsiniz. Yalniz, link ingilizce.

http://www.b17.com/family/lwp/chronology/prehistory.html

Saygilarimla;
evrensel-insan


sayın evrensel verdiğiniz link çok merkezli darwin teorisi ; özellikle verilen kayıtların hepsi düzmece. Teker teker ele alır gerçeğini veririz, burda kilit nokta çin ve mısır.mısır tarihiyle ilgili kamuoyu oluşturmak ve piramitlerin 4. dönemde yapıldığını dünya üzerine yaymak için abd merkezli yoğun bir propaganda var.bununla ilgili bir yazı yazdım şu denetimdeki üye statüsünden kurtulunca basıcam

Diğer bir konu tarih sahnesindeki tüm peygamberler kolaj kahramanlardır. Gerçekte yaşamamış olup hepsi Süleymanın mabedinde uydurulmuş kahramanlardır.(Muhammet hariç).

Bir başka mesele ki , neni oldukça güldürdü ; 7,000-6,800 B.C ler tam komedi.:D:D

Kısaca yazıyı baştan aşağı zaten bering ve dağılımını yazarken çürütecez.

Peygamberler konusunu ise ; blogumda Genesis poblemleri diye br yaz var odan okuyabilirsiniz.üm peygamberler kolaj kahramanlardır. Aynı zamanda Tevratta 150 yıllık bir kayıp zaman söz konusudr ki , ristiyanlar ve yahudiler arasında milenyum kavgasının sebebide budrur

AKHENATON
03-10-2008, 15:55
evet yavaş yavaş devam edip adem ve havva yürüşüyünün bir masaldan ibaret olduğuna devam edelim.

Bilim dalı olarak arkeoloji'nin kökeni 200 yıl öncesine dayanır.Elde edilen bilgiler ağırlıklı olarak dinsel anlatımlar doğrultusunda bir köken yaratmak ve insanlığa bilimsel bir görünüş kazandırılmak istenmiştir.

Gerek insanın kökeniyle ilgili dinsel anlatımlar gerekse kurumsal sistemle yönetilen bilim mekanizmalarının , insanın kökleriyle ingili anlatımlarında hiç bir fark bulunmaz.İki karşıt düşünce derinlikli okunursa aslında aynı anlatım olduğu açıkça ortaya çıkar.Bir görüş aynı tarihsel sürece farklı bir başlangıç diğer karşıtı ise aynı tarihsel sürece farklı bir başlangıç koyar.İki düşünceninde ortak noktası tüm yaşamın dünya üzerinde oluştuğu dünya dışı tüm olguların şiddetle karşı çıkıldığı ve bunu dile getirenlerin gerek din gerekse bilim mekanizmalarında aforoz edildiği gerçeğidir.

Bilimsel disiplinlerde her hangi bir bulgunun akademik düzeyde kabul edilebilmesi için oldukça uzun sürelerin geçmesi gerekmektedir.Kanıtınız somut olsa dahi , bilim otoritelerinin süzgecinden geçmeyen hiçbir somut bilgi bilimsel olarak adlandırılmaz.

Bilim çevrelerinde süzgeçten en ağır şekilde geçen bulgulardan bir taneside Amerika kıtasıdır.Diğerleri ise Hindistan ve çin ve Türk kalıntılarıdır.Özellikle görünmek istenmez.

Eski dünyadan amerika kıtasına ilk seferler 10.yy da kuzey avrupalı denizciler tarafından yapıldığı süphe götürmez bir gerçekliktir.Bu seferlerin gönüllü lideri ise irlandalı rahip Brendanın üstlendiği de genel ve kabul görmüş teoriler arasında yerini alır.Amerika yerlilerinin kültürlerinde iz bırakmayan bu seferler kuzeydoğu da dar bir bölge ile sınırlıdır.
Fakat kuşkucu ve bağımsız bilim adamları bunun ilk tanışıklık olduğu konusunda emin değillerdir.Çünkü orta emerikada elde edilen arkeolojik kalıntılar, bağımsız düşünenler için kafakarıştırıcı bir dizi sorunlarıda beraberinde getirmiştir.

Konuyla ilgili G.Messadie Orta Amerika kültüründe Yoğun Afrika izleri taşıyan La Venta kültüründeki Olmek Heykelleri üzerinden ve okyanusya yerlileriyle orta amerika yerlilerinin kültürleri arasındaki benzerlikten yola çıkarak bölgenin Okyanusya Afrika' dan insanların ziyaretine uğramış olduğunu muhteşem eserinde ortaya koyarak mevcut ortodoksin bilimin tüm tezlerini kumdan kale gibi yıkar.

(Konuyla detaylı ilgilenecekleri için Massadie ile Emel Ersin'in Tük Mitolojisi kitabını beraber okumalarını tavsiye ediyorum)

Aynı şekilde 1976 yılında Venezuellada yüzlerce Roma paras bulunmuştur.Bu paraların en yakın tarihlisi İ.S.IV yüzyılına kadar gitmektedir.Meksika ve Veracruz eyaletindeki bir mezarda Roöalılara ait Venüs heykeli ve ingiliz kolonilerinin İ.Ö.XII uzandığı sanılan bakırdan Çin paraları bulunmuştur.

Bu ve bir dizi bulgular insanlık tarihi için kronoloji hazırlayan bilim dünyası için ciddi rahatsızlıklar ortaya çıkarmıştır.

Bu gelişmelerin ışında Bağımsız kuşkucu bilim, ortodoksin kurumsal üniversitelerin insanlık tarihi anlatımlarını red ederek saf gerçeği aramaya koyulmuşlardır.

Olmek , Maya , Toltek ve İnkaların topraklarında mevcut bilimin insanoğluna dayattığı tarihten daha önce karşılaşma yaşanmışmıdır. ?



Devam Edecek.

dilaver
03-10-2008, 21:01
Akhenaton

Avrupalılar Amerikayı bulana kadar Amerikalılar tekerlegi, ateşi barutu, ateşli silahları bilmiyorlardı. Hayvanları evcilleştirememişlerdi. Kuzey Amerika yerlileri ise hala anaerkil ve komünal yaşantı içerisindeydiler.

Bir şeyler yaz ama eller tutar olsun, hayalden ileri gitsin. Aslında şimdiye kadar yazdıklarını ciddiye almak bile hata ama dur bakalım altından ne çıkacak diye bekliyorum. Umarım bir şeyler çıkacaktır.

Ayrıca bu başlıgı okudugundan da emin degilim. Okumuş olsan genetik açılımlarla ilgili bir şeyler söylemeliydin. Neyse yaz sen gene istedigin gibi.

saygılarımla

AKHENATON
03-10-2008, 22:24
Akhenaton


Ayrıca bu başlıgı okudugundan da emin degilim. Okumuş olsan genetik açılımlarla ilgili bir şeyler söylemeliydin. Neyse yaz sen gene istedigin gibi.

saygılarımla

yahu amma sabırsızsınız.Arkeoloji, antropoloji ve genetik yazıcam dedim.sırayla başladım işte , diğer forumda devam edicem.

Size somut kanıt yazdım işte, umarım Wiskonsini araştırmışsınızdır.

evrensel-insan
04-10-2008, 00:56
Saygideger AKHENATON ve dilaver;

Sizlere daha detayli bilgi verecegini dusundugum, bir linki asagida veriyorum. Verdigim link , cok detayli ve genis.Ayrica baska, linkleri de iceriyor.Yalniz, link ve dili ingilizce.

http://www.ecotao.com/holism/huevo/index.html

Saygilarimla;
evrensel-insan

-InVi-
04-10-2008, 05:10
Akhenaton,
bu darwin ve evrimi dünyanin parasina sahip olan kreatonistciler yikamadi.....
sen (mi) yikacan ....:)

prometheus4517
19-10-2008, 15:17
İnsanlığın göç tarihi: DNA Çalışmaları Kıtalar Boyunca İnsanlığın Kökenlerinin İzini Sürüyor.

DNA, Afrika'dan ta Güney Amerika'nın ucuna kadar süren binlerce yıllık yolculuğun gayet net olan resmini biraz daha parlattı.

Gary STIX

Usame Bin Ladin'in üvey kardeşi tarafından yönetilen bayındırlık şirketi, geçen yıl, Kızıl Deniz'in Hint Okyanusu'na çıkışı olan Babü'l Mendeb boğazı üzerine bir köprü kurmak istediğini açıkladı. Eğer bu iddialı proje gerçekleştirilecek olursa, Mekke'ye gidiş yolculuğunda dünyanın en uzun köprülerinden birini geçen Afrikalı kalabalık hacı toplulukları, insanlık tarihindeki en unutulmaz yolculuğun muhtemel rotasının yüzlerce fit üzerinden geçecekler. Elli veya altmış bin yıl önce, Afrikalı küçük bir topluluk – birkaç yüz, en fazla birkaç bin kişi – aynı boğazı küçük kayıklarla geçti, hem de hiç dönmemek üzere.

Doğu Afrika'daki vatanlarını terk etmelerinin sebebi tam olarak anlaşılamamıştır. Belki iklim değişti, veya bir zamanlar bol olan su kabukluları stokları tükendi. Fakat bazı şeyler gayet belirgin. Afrika'dan ilk çıkanlar, tam anlamıyla modern insanları tanımlayan fiziksel ve davranışsal özellikleri de – büyük beyinler ve dil yeteneği gibi – kendileriyle birlikte getirdiler. Asya kıtasında şimdi Yemen olan yerdeki çadırlarından, kıtalara yayılan ve köprüler kuran ve onca yolu aşıp Güney Amerika'nın en ucundaki Tierra del Fuego'ya kadar ulaşan on binlerce yıllık bir yolculuğa çıktılar.

bilim insanları, elbette, bu gezilere, fosilleşmiş kemikler veya koleksiyonlarda zahmetlice saklanan ve gizlenen mızrak uçları sayesinde bir hayli nüfus ettiler. Fakat antik-elden düşmeler, genelde bu uzak tarihin tam bir resmini veremeyecek kadar azdır. Geçen 20 yıl içinde, toplum genetikçiler, modern insanların ilk göçlerinden kalma bir genetik galeta unu izini şekillendirerek paleoantropolojik kayıtlardaki boşlukları doldurmaya başladılar.

DNA'mızın neredeyse tamamı – insan genomunu oluşturan üç milyar kodun veya nükleotidin yüzde 99.9u – her insanda aynıdır. Fakat son yüzde 0.1deki birleşimler hatırı sayılır farklılıklardır. Güney Afrikalılar ile Amerikan yerlileri arasındaki bir karşılaştırma, mesela, insanlık tarihi ve kıtadan kıtaya kolonizasyonun acımasız bir şekilde gelişimi hakkında son derece önemli ipuçları verebilir. Son yıllara kadar, sadece babadan oğullara veya anneden çocuklarına geçen DNA, genetikçiler için, fosilleşmiş ayak izlerine eşdeğer olarak hizmet edegelmiştir. Son araştırmalar, bütün genoma dağılmış olan yüz binlerce nükleotidi incelemek için ayrılmış birkaç DNA sarmalının arkasındaki görüş alanını genişleterek bilim insanlarının odaklarını ayarlamalarını sağladı.

Geniş taramalar, bazıları henüz geçtiğimiz aylarda yayınlanmış olan, daha önce görülmemiş netlikte küresel göç haritaları üretti. Araştırma modern insanlığın kökeninin Afrika’da olduğu fikrine bir destek sağladı ve bu kıtanın nasıl dünyanın geri kalanına yayılan genetik çeşitliliğin kaynağı olarak kaldığını gösterdi. Kökeninde Afrika’nın San ırkıyla başlayan bir genetik soyağacı, büyüyen en genç dallarında, Güney Amerikalı Kızılderililer ve Pasifik Adalarındaki yerlilerle bitiyor.

İnsan genetik çeşitliliği üzerine araştırmaların geçmişi – tarihsel bir Küresel Konumlama Sistemi (GPS) türü – Yunan şehri Selanik’te çalışan iki doktorun burada konuşlanmış olan askerlerin verilen bir kan grubuna, milliyetlerine bağlı olarak farklı tepkiler verdiğini bulduğu 1. Dünya Savaşı sıralarına kadar uzanır. 1950lerden başlayarak, Luigi Luca Cavalli-Sforza değişik kan grubu proteinlerini inceleyerek ırklar arasındaki genetik farklılıklar araştırmasını şekillendirmeye başladı. Proteinlerdeki çeşitlilikler onları kodlayan genlerdeki farklılığı yansıtır.

Sonra, 1987’de, Berkeley, Kaliforniya Üniversitesi’nden Rebecca L. Cann ve Allan C. Wilson ana soyundan geçen ve hücrenin enerji üreten organeli olan mitokondrinin DNS’sının analizine dayanarak çığır açan bir araştırma yayınladılar. Farklı ırklardan insanların yaklaşık 200.000 yıl önce yaşamış olan, Afrika’daki bir kadının soyundan geldiğini söylediler – mitokondriyal Havva’nın keşfini ilan eden manşetleri attıran bulgu. (İncil’deki imanın aksine, bu Havva ilk kadın değildi: hayatta kalanların hepsi onun soyu olmasına rağmen)

Havva Hakkında Herşey

“Doğal” mitokondriyal mutasyonların – ne yararlı ne de zararlı olanlar – hızlı ve nazaran tahmin edilebilir oranı organellerin moleküler saatler gibi işlemesini sağlar. İki grup veya soy arasındaki mutasyonların sayısındaki farklılıkları (saatin tik-takları) saymak, araştırmacının ortak ataya – mitokondriyal Havva veya yeni bir soy kuran başka bir kadın - kadar giden bir genetik ağaç kurmasını sağlar. Farklı bölgelerden soyların yaşlarının karşılaştırılması insan göçlerinin bir zaman çizelgesinin çizilmesine izin verir. 1987’den beri insan çeşitliliği üzerine bilgi hazinesi sadece erkekten oğluna geçen cinsiyet kromozomu olan Y kromozomunu da kapsayacak kadar genişledi. Erkekten erkeğe iletilen DNA mitokondriyal DNA’nın taşıdığından daha fazla nükleotid taşır (16000 ile karşılaştırıldığında on milyonlarca) ve bu da araştırmacının bir ırkı diğerinden ayırt edebilme yeteneğini arttırır. İnsan ırklarından mitokondriyal ve Y kromozom DNA’larını analiz etmek yüzlerce genetik işaretler çıkardı (belli ırklara özel, tanımlanabilen mutasyonlara sahip DNA alanları).

On binlerce yıl boyunca Afrika’dan Amerika’ya insanların izlediği yol, şimdi, her ne kadar aşırı derecede yavaş olsa da, birbirine bağlı birçok süper otoyolda gezginler hareket ediyorlarmış gibi, harita üzerinde izlenebilir. I-95 gibi alfanümerik yol işaretleri, alfanümerik genetik işaretler olarak yeniden düzenlenebilir. Örneğin Y kromozomunun rotasında olduğu gibi, Arap Yarımadası boyunca Kuzeye yönelirken M89 olan, M168 otoyolunun üzerinde Babü'l Mendeb boğazını geçin. M9la sağa dönün ve Mezopotamya ve ötesine doğru yola koyulun. Hindukuş dağlarının kuzeyindeki bölgeye ulaşınca, sola M45e dönün. Sibirya’da sağa gidin ve sonunda Alaska’ya giden kara köprüsü karşınıza çıkıncaya kadar M242yi takip edin. M3e yönelin ve Güney Amerika’ya ilerleyin.

Mitokondriyal DNA ve Y kromozomu güçlü analitik araçlar olarak kalmaya devam ediyor. National Geographic Cemiyeti, IBM ve The Waitt Family Foundation, esasta bu araçları kullanmaya adanmış, özel olarak finanse edilen – 2010 a kadar 40 milyon dolarlık bir işbirliği – bir araştırmaya katıldılar. 10 tane bölgesel akademik kuruluşun da yardımıyla, sözde Coğrafi Proje, dünya çapında 100.000 e yakın yerlinin DNA örneklerini topluyor. “Üzerine yoğunlaştığımız şey, insanların bu yolculukları nasıl yaptıklarının detayları” diyor, projeye başkanlık yapan Spencer Wells. Projedeki araştırmacılar yeni bir raporda Güney Afrika’daki Khoisan halkının, genetik olarak diğer Afrika’lılardan 100.000 yıldır ayrı durduğunu bulduklarını belirtiyorlar. Başka bir çalışmada, Lübnanlı erkeklerin gen havuzunun bir kısmının Hıristiyan Haçlılara ve Arap yarımadasından Müslümanlara kadar götürülebileceğini gösterdiler.

Güç Aletleri

Genetik araştırmacıları, keşfettikleri göç yolları üzerinde yaşayan birçok insanın DNA örneklerini aldılar. Fakat bilgilerin görünürdeki kesinliği bazen yanıltıyor. İnsan kökenleri üzerine çalışan bilim adamları, yine de, ellerinde tuttukları ve bir soyağacına ait olan bir fosili tercih edeceklerdir. DNA, fosilleri tarihlendirmek için kullanılan radyoaktif izotoplardan dolayı da farklılık gösterebiliyor. Mutasyon oranı bir DNA sarmalından diğerine değişebiliyor.

Fakat paleoantropologların işi çok zor. Fosil kalıntıları çok nadir bulunuyor ve sıklıkla eksik oluyor. Afrika’dan Avustralya’ya en erken göç, mitokondriyal ve Y genetik maddede (diğerlerine nazaran, Andaman Adası yerlileri sağolsun) kendini gösteriyor, fakat yol boyunca fiziksel kalıntılar çok büyük oranda kayıp.

Taşların ve kemiklerin yokluğuna çözüm: nereden olursa olsun daha çok DNA. Genetikçilere örnek çoğaltmak için, araştırmacılar insanlar üzerinde yolculuğa katılan mikroplara baktılar, göçün benzer öğelerini aramak için genlerini incelediler. Kaçak yolcular, bakterileri, virüsleri ve hatta bitleri dahi içeriyor. Mikroorganizmaların yanı sıra, İnsan Genomu Projesi ve bütün genomun büyük bilinmez boşluğunu araştıran diğer çabalar genetik yöntemlerdeki eksiklikleri telafi etmeye yardımcı olan birçok güç aletleri üretti. “Farklı hipotezleri test ederken daha fazla istatistiksel güç elde etmek için birçok bireyin ve birçok ırkın genomunda çok farklı yerlere bakabilirsiniz.” diyor Tim Weaver, Davis Kaliforniya Üniversitesi’nden bir antropoloji profesörü.

Son on yıl boyunca, araştırmacılar bir yığın değişken veya çok biçimli, genomun üç milyar nükleotidinin arasına serpişmiş alanı eşzamanlı karşılaştırarak inanılmaz keşifler yaptılar. Son on yıldaki ilk bütün-genom çalışmaları mikrouydular olarak bilinen kısa tekrarlı DNA sarmallarının ırklar arasındaki farklılıklarını araştırdılar. Yakın zamanda, bütün-genom çalışmalarının vesilesiyle çalışma alanı ilerilere genişledi. Şubat ayında iki araştırma, biri Science dergisinde, diğeri Nature dergisinde, insan çeşitliliğini tarihlendirmek için yapılan en geniş tetkikleri bildirdi. Her ikisi de İnsan Genomu Çeşitliliği Paneli’nden 500.000 den fazla tek nükleotid çok biçimliliğini (SNP’ler) – DNA’da özel bir alanda bir nükleotidin diğerine değişimi – incelediler. Bu hücre hatları dünya çapında 51 ırktan yaklaşık 1000 bireyden çekilmişti ve Paris’teki İnsan Çeşitliliği Araştırma Merkezi’nde korunmuştu.

İki araştırma ekibi biriken bilgiyi farklı yollarla analiz ettiler. Direk olarak uzak ırklar arasında SNP’leri karşılaştırdılar. Ayrıca haplotipleri de (bozulmadan nesiller boyunca aktarılan ve birçok SNP içeren DNA blokları) incelediler. Nature dergisindeki araştırmaları yazan grup ayrıca bir kişinin genomu boyunca 1.000.000 nükleotid uzunluğuna (kopya sayısı çeşitlilikleri) kadar DNA sarmallarının tekrarlarını veya silinmelerini karşılaştırarak insan çeşitliliğini tetkik etmenin yeni bir tekniğini keşfetti. Ann Arbor’daki Michigan üniversitesinden ve aynı zamanda Nature dergisinin de baş yazarı olan Noah A. Rosenberg, “genomun herhangi bir parçası, bir bütün olarak genomun atasını yansıtması gerekmeyen bir tarih taşır” diyor. Fakat aynı anda birçok alana bakmanın problemi çözeceğini açıklıyor: “binlerce işaretle, insan göçlerinin genel tarihini belirlemek mümkündür.”

Yüzbinlerce SNP’ye bakmak, araştırmacıların ırkların kimliklerini çözebilmelerini sağladı ve genetik olarak yakın ilişkilerin genişleyerek ve uzaklara nasıl yayıldıklarını görebilmelerini. Güney Amerika yerlilerinin soyları Sibiryalılarda ve diğer Asyalılarda bulundu. Çin’in öz etnik grubu olan Han halkının, ayrı güneyli ve kuzeyli ırkları vardır. Bedeviler Ortadoğu’dan olduğu kadar Avrupa’dan ve Pakistan’dan gruplarla da ilişkilidir.

Antropoloji, arkeoloji, dilbilim ve biyolojiden (önceki mitokondriyal ve Y DNA çalışmaları da dâhil) geçmiş araştırmalarla örtüşen bulgular, ayrıca, insanların küçük bir nüfusunun kıtadan dışarı çıktığı, sonra diğer bir “kurucu” alt grup kopup ayrılana kadar yeni bir yurtta çoğaldığı – bütün dünyaya yerleşilene kadar böyle kendini tekrar eden bir süreç – fikrini destekleyen Afrika’dan Dışarı tezi için daha geniş bir istatistiksel temel sağladı. Bu yolcular antik insan ırklarına yanaştı – Homo Neanderthalensis ve Homo Erectus – karşılaştıklarında iç üreme çok azdı veya hiç yoktu. Yeni DNA çalışmaları, daha küçük bir grubun her ayrılışında, Afrika ırklarında orijinal olarak var olan genetik çeşitliliğin sadece küçük bir alt grubunu taşıdığını belirtiyor. Böylece Afrika’dan mesafe (ve zaman) uzadıkça, ırk hareketlerinin takip edilmesini kolaylaştıran bir araç sağlayarak, çeşitlilik azalır. Amerikan yerlileri, son büyük kıtasal göçlerin konukları, genomlarında Afrikalıların sahip olduklarından daha az çeşitliliğe sahiptir.

Birçok bilim insanı Science ve Nature dergilerindeki gibi geniş istatistiksel analizlerle desteklenen kanıtların ağırlılığının, insanın kökeni üzerine uzun koşu bu tartışmada Afrika’dan Dışarı tezinin savunucularına kesin bir sınır çizdiğine inanıyor. Multiregional hipotezi – Afrika’dan Dışarı tezine bir rakip – H. Erectus gibi arkaiklerden türeyen ırkların son 1.8 milyon yıl boyunca Afrika, Asya ve Avrupa’da evrim geçirdiğini ve derece derece Homo Sapiens’e ulaştığını savunur. Rastgele iç üremeler grupların ayrı ırklara bölünmediğini kanıtlıyor.

Birkaç bilim adamı hala multiregionalism teorisinin titizlikle yorumlanması gerektiğini savunuyor. Fakat çoğunluğu Homo Sapienlerin hominid kuzenlerimizle karşılaşmalarımızın genetik izlerini taşıyıp taşımadıklarını tespit etmek için verilen çabalar olmak üzere, farklı versiyonlar da konuşuluyor. Hint Teknoloji Enstitüsü’nden Vinayak Eswaran, Utah Üniversitesi’nden Henry C. Harpending ve Alan R. Rogers’ın da yardımıyla son yıllarda, insanların Afrika’dan göçtükten sonra Homo Erectus gibi arkaik türlerle yoğun olarak iç-üreme yaptığını öne süren bir simülasyonlar teorisi ortaya attı. Eswaran’ın modeli modern insan genomunun yüzden seksen kadarının bu tür iç üremelerin etkilerine maruz kalmış olabileceğini iddia ediyor.

Genetik etkiler iç üreme olduğunda umulan kadar görünür değil, fakat Harpending bir açıklama sunuyor.Afrikalı göçmenler tarafından taşınan yararlı bir takım gen, belki de çocuk yetiştirmede yardımcı olanlar, en sonunda bazı arkaik genlerin izini ortadan kaldıran seçici bir avantaj getirdi. Harpending, “Sonuç, ırkın istenen genlerin (Afrikalı) kaynak ırkına gerçekte olduğundan daha yakın görünmesidir.” diyor.

Biz de bir miktar Neandertal miyiz?

Eswaran ve Harpending türler arası randevuları savunan tek isimler değiller. Homo Sapienlerin fosilleşmiş kalıntılarından bazıları, önceki hominidleri andıran özellikler taşıyor ve çağımız insanlarının genetik kayıtları tartışmaya malzeme sağlıyor.

Genetik soyları belgeleyen ağaç şemalarına göre bazı gen değişkenleri çok daha kadim atalara tanıklık ediyor – insanların 200.000 yıldan daha önce var olmamış olan tek bir homojen gruptan evrimleşmiş olabileceğinden çok daha yaşlılar: muhtemel iç üremeye bir ipucu. 2006’da dikkat çeken bir araştırmada Chicago Üniversitesi’nden Bruce T. Lahn ve meslektaşları, beyin boyutunu düzenlemede görev alan Mikrosefalin geninin bir versiyonunun 40000 yıl önce Neandertallerle bir karşılaşma sırasında geçmiş olabilecek bir haplotip içerdiğini bildirdiler.

Daha kesin bir cevap önümüzdeki 12 ay içinde gelebilir. Neandertal Genomu Projesi – Almanya Leipzig’deki Evrimsel Antropoloji için Max Planck Enstitüsü ile Connecticut merkezli bir sıralama şirketi 454 Life Sciences’ın işbirliği – Hırvatistan’da bir mağarada bulunan 40000 yıllık Neandertal kemiklerinden yaklaşık yüzde 70lik kısmının taslağını bitirmek üzere bu yılın sonuna programlandı. Sonuçlarının altı ay kadar sonra yayınlanması bekleniyor.

Şimdiye kadar proje, iki hominid soyu arasında DNA transferini kanıtlayabilecek herhangi bir genetik modelin izine rastlamadı. Projeyi yürüten Max Planck profesörü Svante Paabo “Bu konuda hiçbir kanıt görmüyoruz, fakat bunu hariç tutamayız.” Diyor. Onun grubunun, bütün genomun önemsiz bir parçası olan bir milyon nükleotidi tetkik eden önceki bir yayını bazı gen değişimlerinin oluşmuş olabileceğini öneriyor, fakat daha sonra örneğin defosundan dolayı yanlış bir iz olduğu bulundu. Araştırmacılar Lahn’ın bahsettiği mikrosefalin değişkenine henüz rastlamadılar.

Bir örneği elle tutmak ve hatta üzerinde nefes alıp vermek, antik DNA’nın üzerinde çalışılmasına engel olur: bazı antropolojistler kendilerini temiz odalarda mikroçip fabrikalarında kullanılan takımlara sararlar. O ilk araştırmadan beri, Paabo’nun laboratuarı Max Plank’taki temiz odalarda kullanılan yöntemleri değiştirdi. Araştırmacılar her Neandertal genetik malzeme lifinin başlangıcına sentetik DNA’nın dört nükleotidinden yapılma etiketler yerleştiriyorlar. Sıralama makinesini geçen her lif moleküler kimlik kontrolünden geçiyor.

İnsan çizgisindeki en yakın kuzenlerin genetik makyajını anlamak – daha önceki çalışmalarda da görüldüğü gibi genomların yüzde 99,5 oranında benzer olduğundan hareketle – insan genomunda iç üremelerin meydana geldiği ve doğal seçilimin belli yolları tercih ettiği alanların kimliklendirilebilmesini sağlayarak karşılaştırılan genomlarda tarihlendirme için en kesin ön çalışmayı sağlayabilirdi. “Bence, eğer insan evrimiyle ilgileniyorsanız, Neandertaller eşsizlerdir.” diyor Paabo. “Bizim en yakın akrabalarımızlar. Teknik olarak zor olmasına rağmen, genomlarına erişebilirsiniz. Fakat diğer antik insan gruplarının çoğu için, bu mümkün olmayacaktır.”

Yeni ve hala yayınlanmamış bir çalışma Neandertallerin Y kromozomunun insanlarınkinden farklı olduğunu açıklıyor. İnsan ve Neandertal mitokondriyal DNAlarının bariz bir şekilde ayırt edilebilir olduğunu gösteren çalışmaları yansıtarak “Hiçbir insanın bir Neandertalinki gibi bir Y kromozomu yoktur.” diye gözlemliyor Paabo. Geçen Kasım ayında Paabo ve ekibi iki hominid arasında bir benzerliği bildirdi. İspanyadan Neandertal kalıntıları FOXP2 diye bilinen bir genin bir versiyonunu taşıyordu ki bu gen insanlarda konuşma ve dil gelişimi ile ilgili bir gene özdeştir. Yine, Nisan’da farklı bir grup tarafından yayınlanan bir araştırmada, kirlenme riskinin göze alınmamasına rağmen genin iç üremenin sonucu olduğuna dair spekülasyonlar baş gösterdi.

Biz Nasıl Uyum Gösterdik

Araştırmacıların bir kısmı insanların Homo geninin diğer türleriyle ilişkiye girip girmediğini keşfetmek için eski kemik kalıntılarından DNAları sıralamaya devam ederken, diğer araştırmacılar göçmenler yeni evlerine uyum sağlarken, genetik yolculuk (rastgele mutasyonlar) ve doğal seçilim boyunca hangi genetik izlerin değiştiğini görmek için DNA’nın genom genişliğindeki analizlerini uyguluyorlar.

Nature dergisinde Şubat ayında yayınlanan bir çalışma insanlar Afrika’yı terk ettikçe genetik çeşitlilikteki azalmanın sonuçlarını gösterdi. Proje 20 Avrupa-Amerikalı ve 15 Afrika-Amerikalı gruptan 40000 SNP yi karşılaştırdı. Avrupa-Amerikalılarda daha yüksek oranda zararlı genetik değişiklik olduğunu buldu. Yazarlar sağlık hakkında spekülasyon oluşturmaktan çekiniyor olmalarına rağmen, bunlar hastalıklara potansiyel olarak Afrika-Amerikalılardan daha yatkın. Araştırma bilim adamı Carlos D. Bustamante’yi Avrupa’nın kuruluşuna “nüfus genetik ekosu” demesine neyin ittiğini gösteriyor. Avrupa’nın başlangıçtaki küçük nüfusunun genetik çeşitlilik azlığı bir takım zararlı mutasyonların genişçe yayılmasına ve insanların sayısı arttıkça yeni zararlı mutasyonların oluşmasına olanak sağladı. Doğal seçilimin zararlı değişimleri yok edecek kadar zamanı olmamıştı.

Genom çapında araştırma ayrıca doğal seçilimin göçmenlerin yeni çevrelere uyum sağlamasında nasıl yardımcı olduğunun panoramik resmini parlatmaya başlıyor. Geçen iki yılda birçok araştırma insanlar Afrika’yı terk ettikten veya tarımı keşfettikten sonra oluşan ve zor koşullarda hayatta kalmak için faydalı olduğu görülen genetik değişimleri aradı. Genetik altın avcıları, bir haplotipler kataloğu olan ve Japonya, Çin ve Nijerya’daki bireylerden elde edilenler ile ataları kuzeybatı Avrupa’dan olan Kuzey Amerikalılardan elde edilmiş 3,9 milyon SNP yi barındıran Uluslararası HapMap’i kazdılar.

Harpending’in yardımcı yazarlık yaptığı bir çalışma DNA’nın değişme oranının ve böylece evrimin ilerleme hızının son 40.000 yıl boyunca arttığını gösterdi. Cambridge, Massachusetts’teki Broad Institute’den Pardis C. Sabeti ve meslektaşlarının yaptığı bir diğer çalışma, hastalıklara gösterilen direnci ve cilt rengi ile teri düzenleyen saç foliküllerini yöneten alanlar dahil genomun yüzlerce bölgesinin hala seçilim geçirdiğine işaret ediyor. Bu bulgular insan popülasyonlarının güneşe maruz kalmadaki bölgesel farklılıklara ve Afrika’yı terk ettikten sonra karşılaştıkları yiyecek ve patojenlere uyum sağlamaya devam ettiğini ima ediyor. Ve ayrıca Afrikalıların da çevreleri değiştikçe evrildiğini.

Paris’teki Pasteur Institute’ten Lluis Quintana-Murci’nin yönettiği en yakın çalışmalardan biri, diabet, obezite ve yüksek tansiyonda rol oynayan birkaç tanesi dahil 580 genin HapMap popülasyonları arasında farklı olarak seçilime uğradığını gösterdi, bu beklide hastalık türlerindeki coğrafi farklılıkları açıklıyor ve geliştirilen ilaçlara yeni hedefler için ipuçları sağlıyor.

İnsan çeşitliliğinin altında yatan süreçlerin düşünülmesi bazen saç foliküllerinin çapının ve sütü sindirebilme kabiliyetinin ötesine gider. Irkları ve etnik kökenler neyin teşkil ettiği tartışması hemen resme girer. Eğer bilinçle alakalı bir gen değişkeni Avrupalılarda Afrikalılardan daha çok bulunursa bu ne anlama gelir? Genetiğin insanlar tarafından daha iyi anlaşılması – tek bir genin zekilik ile aptallığı ayıran bir anahtar gibi rol alamayacağı – yanlış yönlendirilen spekülasyonların önüne geçebilir.

Genetik literatür, Asyalı veya Çinli gibi bir terimin, Çin’in güneyli ve kuzeyli Han grupları arasındaki farklılıklar gibi yakın zamanlarda yapılan genom çapındaki araştırmalarla bulunan atalara ait genetik donanım farklılıklarına dayanan daha zarif sınıflandırmalarla yer değiştirmesini sağlayacaktır. Quintana-Murci “Hiçbir ırk yoktur” der. “Genetiğin bakış noktasından gördüğümüz coğrafi eğimlerdir. Avrupalılar ile Asyalılar arasında keskin farklılıklar yoktur. İrlanda’dan Japonya’ya bir şeylerin tamamen değiştiği keskin bir sınır yoktur.”

Karşılaştırmalı genbilimin ortaya koyduğu evrimsel tarih boyunca yolculuk hala devam ediyor. Bu sırada, daha fazla bilgi, daha güçlü bilgisayarlar ve algoritmalara olan açlık sınır tanımıyor. Yığılan daha büyük veritabanları – ocakta uluslar arası bir konsorsiyum farklı bölgesel popülasyonlardan 1000 genomu sıralamayı niyet ettiğini açıkladı – araştırmacıların insan evriminin alternatif modellerinin çok daha gerçekçi simülasyonlarını çalıştırmalarına ve her birinin ihtimallerini ölçmelerine izin verecek ve kim olduğumuz ve nereden geldiğimize dair şimdiye kadarki en iyi resmi gösterecek.

Not: Bu makale orijinal olarak “Uzak Bir Geçmişin İzleri” başlığıyla yayınlanmıştır.

Kaynak: http://www.sciam.com/article.cfm?id=the-migration-history-of-humans


Dipnotlar:
1Türkçe adını bulamadım
2Türkçe adının bu olduğunu tahmin ediyorum. Kontrol ediniz: İngilizcesi organelle
3Hem harf hem rakam içeren anlamında Türkçe başka bir terim varsa o kullanılmalı. Bulabildiğim en mantıklı terim buydu.
4Türkçe adı bu. Değiştirmenize gerek yok.
5Türkçe bir ad bulamadım. Afrikadaki bir halk. Varsa değiştiriniz.
6Birçok bölgede insan kökeninin aynı anda ortaya çıkıp geliştiğini savunan teori. Türkçe bir adı olması lazım. O yüzden ben bir isim vermedim. Ayrıca birkaç yerde Afrika’dan Dışarı tezi diye bir tez geçiyor. O da konuyla ilgili alanlardan araştırılmalı. Türkçede farklı bir adı olabilir. Eğer varsa yazılmaması çok yanlış olur.
7Diğer köken tezi de bu.

Ayejj
04-07-2009, 13:47
TD sitesinin çalışkan aynı zamanda paylaşımcı temel taşı yazarlarından Dilaver'in

''Adem ile Havva'nın Uzun Yürüyüşü '' başlığı başka sitelerdeki tartışmalarda referans olarak kullanılıyor.

http://forum.ateizm2.org/index.php?showtopic=24169&st=20

Sn Dilaver'e güzel paylaşımları için teşekkür ediyorum.

metee
05-07-2009, 09:46
Dilaver Dostum Konuları okuyorum.
Tek taraflı olarak yazmışsın.Bu biraz benim koptuğum anlar oldu..

mtDNA Ağaçlar ve Diğer küçük canlılara baktığımızda Genetik bilimadamları mtDNA olayını tam ters ile ele almaya başladılar..Çünkü İnsanlardaki hastalıklar mtDNA olayını çürütmüştür.Diğer yazılarımd LİOP arkadaşa bu konu hakkında bilgi vermiştim..

Güzel Çalışma Ellerine Sağlık..

Tşklr.

saygılarımla


"Okudum, unuttum, gördüm, hatırladım, yaptım, öğrendim"

"Sana bir şeyi nasıl bilebileceğini öğreteyim mi? Bildiğin zaman bildiğini anla, bilmediğin zaman ise bilmediğini anla."


"Şimdi Tiyatro Başlıyor Sus..Baktım Tiyatro Boş Tek ben varım ve izliyorum..Neden mi Korku mu? Yoksa İçimdeki Sesi duymamak için mi geldim ?
Anlamadım baktım...
Baktım...
Ve bakmakla bakıyorumda bu nasıl bir tiyatro diye soramadım...
Sonra Tiyatro bitti ve gitme vakti geldiğinde gitmek istemiyordum..
Anlamak..
Anlamak..
Anlamak istiyorumdum içimdeki sesi anlamak..
Yanlış..
Sonra düşündüm elimdeki değerleri kaybetim.Bir kez daha şans verin demek istiyordum.
Sonra bir rüya olduğunu gördüm..Bir kez daha şans verilmişti.
Bu kez elimdeki değerleri kaybetmeden bu Sarayı gezecektim.

("Tiyatro Konusu: Uyanış") Kendine güveniyorsan bildiğini sorgularken, sorduğun sorunun cevabını aldığına tam tatmin olunca kadar sorgula o zaman istediğin cevaplar seni bulacaktır.......?


Sana profesörler değil kendin olarak yetersin..Yeterki kendi bildiğini sorgularken M harfini değiştirerek değil..Değiştirmeden yapmaktır...M Harfi M kalacaktır..O zaman zorlanmazsın..

Ayejj
05-07-2009, 10:56
Dilaver Dostum Konuları okuyorum.
Tek taraflı olarak yazmışsın.Bu biraz benim koptuğum anlar oldu..

mtDNA Ağaçlar ve Diğer küçük canlılara baktığımızda Genetik bilimadamları mtDNA olayını tam ters ile ele almaya başladılar..Çünkü İnsanlardaki hastalıklar mtDNA olayını çürütmüştür.Diğer yazılarımd LİOP arkadaşa bu konu hakkında bilgi vermiştim..


Sn meteee,

Büyük sözler ediyorsun.Atıp tutuyorsun ama ortaya koyduğunuz bir bilgi yok. Sizin gibi çoklarını gördük. Böyle beylik laflarını sıralarsınız sonra iş gerçek bilgilere geldiğinde kimse görmeden sıvışmaya çalışırsınız.

metee
06-07-2009, 00:32
Sn meteee,

Büyük sözler ediyorsun.Atıp tutuyorsun ama ortaya koyduğunuz bir bilgi yok. Sizin gibi çoklarını gördük. Böyle beylik laflarını sıralarsınız sonra iş gerçek bilgilere geldiğinde kimse görmeden sıvışmaya çalışırsınız.


Hangi konuda istersen cevap verebilirim.Kaçmıyorum burdayım kardeşim.

Gerçek bilgiler dediğin bir teoriyi savunmaksa sen bildiğinle kal..

Zamanında birçok bilgiler verdim.Lamerler sayesinde çoğu silindi arkadaşım.
Olanlar zaten duruyor..

Saygılarımla

Deniz ne kadar dalgalı olsa sonunda durulur. GOETHE

Ayejj
06-07-2009, 11:56
mtDNA Ağaçlar ve Diğer küçük canlılara baktığımızda Genetik bilimadamları mtDNA olayını tam ters ile ele almaya başladılar..Çünkü İnsanlardaki hastalıklar mtDNA olayını çürütmüştür.


O zaman burdan başla bizde öğrenelim bakalım.

metee
06-07-2009, 12:31
MTDNA YANILGISI







Mitokondri ökaryotik hücrelerin, enerji üretimi görevini üstlenen ve kendi DNA’sına sahip sitoplazmik bir organeldir. Sayıları enerji ihtiyacına göre, hücreden hücreye değişen mitokondriler, 1-7 mikrometre uzunluğunda çubuk şeklinde veya 2-3 mikrometre çapında küresel yapılardır.Mitokondrial proteinlerin % 2'si mitokondrial genom tarafından sentezlenirken, % 98'i nükleer gen tarafından sentezlenerek, mitokondriye taşınır. İç membranın geçirgen olmaması nedeniyle, nükleer genom tarafından sentezlenen proteinlerin ve metabolitlerin matrikse taşınımı için spesifik mekanizmalar mevcuttur. İç membrana gelen yağ asidi, aminoasit ve karbonhidratlardan oksidatif yıkımla yüksek enerjili ATP sentezlenerek, hücrenin enerji ihtiyacı sağlanır.
Mitokondri nükleus dışında DNA'ya sahip tek organel olup, ilk kez 1963'de Nass ve arkadaşları, mitokondri içerisinde DNA karakteristiğinde fiberlerin varlığını gösterdiler. 1981'de de Anderson ve arkadaşları tarafından genom dizisi tam olarak gösterildi.

Tek Havva olayı mtDNA birlikte Evrimcilerin ortaya attığı yeni teoridir.Bu teoriye göre insanların ilk atası tek havva'da (Bir Dişi Kadın) geldiğini savunmaktadır.Tek dişi kadın atası Afrika bölgesinde tüm dünyaya yayıldığını böylelikle Asya,Avrupa,Amerika ve Avustralyada insan topluluğu oluşturduğunu savunuyorlar.mtDNA olayı şuanda tam tersi bir cevap ile evrimcilere yaklaşıyor.Havva olayına bakıldığında bir çok havva olması lazım yada bir çok Adem lazımdır.Çünkü günümüzdeki genetik bilimadamları mtDna Dizilimi sadece anne üzerinde olmadığını kanıtlayan genetikçiler,Bir Adem yani bir erkek olması gerekliğini belirtiyorlar..Evrimciler bu konuyu neden tek dişi üzerinde insan atalarını oluştuğunu savunmuştur.Balık türlerinin bazılarınında kendi kendini döleyerek bir döngü içinde yavrularını bıraktığını gözlemişlerdir.Buna göre yola çıkarak mtDNA evrimciler için tek dişi kavramı olumlu geldiği için devam niteliğinde teoriye yeni isimlerle gelmeye başlamışlar.Ama şu durumda bakıldığında evrimci bilimadamları halen modern insan ne zaman ve nerde oluştuğunu bilmediği için maymun cenneti Afrika seçilmiştir.Neden Asya veya Amerika değilde Maymun ceşitleriyle dolu olan Afrikayı seçmişlerdir.Son mtDNA olayını tek dişi Afrika bölgesinde kendi kendine yeni nüfuslar oluşturarak yayıldığını savunuyorlar.Bu tek dişi kendi kendine nüfus oluşturma olasılığı olmadığını gözlemek mümkündür.Kendi kendine nüfus mutasyon demekdir.Mutasyon ise insan nüfusları oluşturma olasılıkları arasında daha değişik türlere evsahip etmesi gerekirdi.



İnsan mitokondrial hastalıklar genellikle mitokondrial DNA (mtDNA), bir disfonksiyon point mutasyonları, silme veya depletions özellikle kaynaklanır.Yani evrimcilerin Tek Havva olayı ancak değişik türde nüfusu olmayan bir canlı türüne meydan hazırlamak istemiştir.Anacak mutasyon evrim sayılmıyor..

Mutasyon temel olarak yüzbinlerce bazdan oluşan DNA molekülünde baz çiftlerinde olan değişikliklerdir. Bir baz çiftinde olan değişiklik bile canlının yaşamını etkilemeye yetebilir. Mutasyon genetik çeşitliliğin en olağan kaynağıdır. Evrimi yönlendiren en önemli süreçtir. Yeni mutasyonların çoğu canlı için zararlıdır. Ama bazıları ya nötraldir, ya da yararlıdır. Genel olarak mutasyon oranı düşüktür. Bakterilerde 10 milyon nesilden yalnız birinde ortaya çıkar. Diğer canılarda oranı az veya çok olmak üzere değişebilir. Ender karşılaşılan yararlı mutasyonlar evrimden sorumludurlar. Zararlı mutasyonların oranı daha çok olduğundan mutasyon oranını genel olarak düşük olması canlılık için yararlıdır.



"DNA-RNA
POLİMERAZLAR
tRNA

mtDNA
RİBOZOM
ŞAPERONLAR" Burda belirtiğim konular üzerinde evrimciler amino asid ve diğer emzimleri değiştirerek bazı mutasyonlar oluşturmak istiyorlar..Ama bu durumda zaten kendilerinin bir mutasyon teorisi bulunmaktadır.

mtDNA ve Tek havva olayına baktığımızda evrim ancak insanlar arasında mutasyon geçirmiş canlı grupları oluşturarak yanlarına melez veya değişik canlı nüfuslarını oluşmasını sağladığını söylüyor.

Ama baktığımızda tek bir insan nüfus görülmektedir.Bunlar bazıları renk,kafa, gözler ve vücut yapılarıyla herhangi bir mustasyon kısmı yoktur..



Ünlü paleontolog Stephen Jay Gould da bu görüşü destekliyor. "Havva Hipotezi" için, "Kalıbımı basarım, müthiş bir buluş bu. Çünkü, hepimizi, şimdiye kadar fark etmediğimiz yakınlıkta, birer biyolojik kardeş yapıyor."

"Aynı ailenin çocukları gibi" diye tamamlıyor, California Üniversitesi biyologları.

Evrimci bir paleontolog ise, "DNA'lardan elde edilen bu yeni bilgiler öylesine hassas, öylesine gerçek ki, bizim anlattıklarımızın hepsi, bir anda kocakarı hikayesine dönüverdi." diyerek "Biz sizi bir erkek ve bir dişiden yarattık." ayetini bilmeyerek tasdik ediyorlar.





Mitokondria üre siklusu, glukoneogenezis, b oksidasyon, krebs siklusu ve en önemlisi de oksidatif fosforilasyon fonksiyonunda görevli yüzlerce protein içerir. Herhangi bir nedenle olusacak mitokondrial disfonksiyon tüm sistemleri etkileyecek ve esik degere (threshold effect) göre semptomlarini verecektir.

Ilk kez 1962'de Luft ve arkadaslarinin myopatili bir vakayi bildirmesinden sonra, mitokondrial hastaliklarla ilgili incelemeler baslamis ve sayilari gün geçtikçe artmistir. Klinik morfolojik ve biyokimyasal siniflandirmalarda mevcut olmakla birlikte en tanimlayici olan genetik siniflandirmadir.

Iskemi, anoksi, mitokondrial fonksiyon için gerekli komponentlerin eksikligine neden olan malnütrisyon, iyi tedavi edilmemis diabetes mellitus ile hipotroid myopatide oldugu gibi hormon ve nörotransmitter defektleri, viral enfeksiyonlar, alkol, antitümöral, antibakteriyel (tetrasiklin, kloromfenilkol), antikonvülzan ilaçlar (valproik asit), toksik etkileriyle ve dogal olarak yasin ilerlemesiyle sekonder mitokondrial fonksiyon bozuklugu bulgulari saptanabilir.

Mitokondrial proteinlerle ilgili nükleer DNA defektleri (Mitokondrial proteinlerin % 98'i nükleer gen tarafindan sentezlenip, matrikse tasiniyor) ile otozomal geçis gösteren intergenomik sinyal defektleri de mitokontrial disfonksiyona neden olurlar ve çok genis bir grup hastaligi içerirler.

"Mitokondrial DNA hastaliklari" deyimi ile; primer olarak mt. DNA'ya ait mutasyonlar sonucu olusan sporadik veya kendine özgü maternal geçis özelligi gösteren, mitokondrial enzimlerin kodlanmasinda veya translokasyonundaki bozukluklar anlasilir.
Mitokondrial DNA mutasyonlarini 3 grup altinda toplayabiliriz.



Kas: Halsizlik, kuvvetsizlik, egzersiz intoleransi, progresif eksternal oftalmopleji, pitosis, kas biyopsisinde RRF, yag depolanmasi, elektron mikroskopide mitokondrial proliferasyon, parakristalin inklüzyonlar.
Beyin: Demans, myoklonus, ataksi, geçici hemiparazi, hemianopi, fokal nöbetler, basagrisi, mental retardasyon.
CT/MR: Bazal gangliada kalsifikasyon, düsük yogunluk, özellikle de parieto-oksipital bölgelerde enfarkt.
Göz: Pigmenter retinopati, katarakt, optik atrofi.
Kulak: Sensorionöral isitme kaybi
Kalp: Kardiyomyopati, kalp blogu
Böbrek: Tübüler defektler (Fanconi sendromu)
Kemik iligi: Pansitopeni, hemopoetik hücrelerde vakuolizasyon.
Endokrin: DM (Tip I ve II). hipoparatroidizm, kisa boy, büyüme hormonu eksikligi, infertilite, puberte gecikmesi.
Pankreas: Ekzokrin pankreas disfonksiyonu
GIS: Diare, malabsorbsiyon, epizodik kusma, divertikülozis, pseudo-obstrüksiyon, villöz atrofi.
Karaciger: Açiklanamayan hepotasellüler disfonksiyon.
Metabolik: Açiklanamayan laktik asidozis, BOS'da laktik asidozis ve laktat/pirüvat oraninin 20'nin üzerinde olmasi.
Ani Ölüm
Maternal kalitim özelligi


mtDNA hastalıkları ve diğer bölge bulunan hastalıklar insan,ağaçlar ve diğer canlılar arasında geçiş imkanı tanımıyor.

Saygılarımla..MeTeE

DEVAMI Gelecektir.

Ayejj
06-07-2009, 12:58
Sn metee,

Siz mtDNA nın evrim açısından önemini anlamamışsınız..

mtDNA daki bozulmaların evrimsel önemi şöyle açıklayayı.

Bir anakara var birde anakaradan uzakta bir ada var.Anakaradaki insanların mitokondrilerindeki DNA ya bakıp ordaki bir mutasyonu işaretleyip ,

Uzaltaki adada yaşayan insanların mtDNA larında aynı mutasyonun olup olmadığına bakarsınız.

Eğer varsa bu adadakilerle karadakilerin akraba olduğunun gösterir.

Sizin analattıklarınızın evrimle ilgisi yoktur.İnsanlar mitokondri DNA larındaki mutasyonlar sonucu evrimleşmiştir şeklinde bir iddia yoktur.

metee
06-07-2009, 21:30
Kas: Halsizlik, kuvvetsizlik, egzersiz intoleransi, progresif eksternal oftalmopleji, pitosis, kas biyopsisinde RRF, yag depolanmasi, elektron mikroskopide mitokondrial proliferasyon, parakristalin inklüzyonlar.
Beyin: Demans, myoklonus, ataksi, geçici hemiparazi, hemianopi, fokal nöbetler, basagrisi, mental retardasyon.
CT/MR: Bazal gangliada kalsifikasyon, düsük yogunluk, özellikle de parieto-oksipital bölgelerde enfarkt.
Göz: Pigmenter retinopati, katarakt, optik atrofi.
Kulak: Sensorionöral isitme kaybi
Kalp: Kardiyomyopati, kalp blogu
Böbrek: Tübüler defektler (Fanconi sendromu)
Kemik iligi: Pansitopeni, hemopoetik hücrelerde vakuolizasyon.
Endokrin: DM (Tip I ve II). hipoparatroidizm, kisa boy, büyüme hormonu eksikligi, infertilite, puberte gecikmesi.
Pankreas: Ekzokrin pankreas disfonksiyonu
GIS: Diare, malabsorbsiyon, epizodik kusma, divertikülozis, pseudo-obstrüksiyon, villöz atrofi.
Karaciger: Açiklanamayan hepotasellüler disfonksiyon.
Metabolik: Açiklanamayan laktik asidozis, BOS'da laktik asidozis ve laktat/pirüvat oraninin 20'nin üzerinde olmasi.
Ani Ölüm
Maternal kalitim özelligi


mtDNA Mutasyon olasılığında çıkan rahatsızlıklar ve bunlar mtDNA'yı bitiren hastalıklarının geçiş imkanı tanımadı bir kaç hastalıklardır.

Mutasyon sonucu evrim geçiren tek insan bu duruma geldi diye bir olay olmaz.Günümüzde mutasyon örnekleri halen mevcuttur.Günümüzdeki mutasyon geçiren canlılar bir canlı türü sınıfına girmiyor..

Evrim mutasyon süreçinde geçmiş ise ozaman günümüzde 6 ve daha fazla ayaklı canlılar ve yarı insan yarı dört ayaklı memeliler olması lazımdır..

Evrim mtDNA sarmal haritasına göre amino asitleri ve diğer emzimleri silme veya değiştirme yolu ile ilerme yapmak istiyor.Ama bu Sarmal harita kodları diğer tüm canlılar mtDNA olayını doğrulamacak kadar karışık ve günümüzdeki ADEM-HAVA yaratılışını destekleyen br tez oluyor. Çünkü baktığımızda insan toplulukları arasında akrabalık olduğu farkına varıldı.En son evrim ne yapam diye düşünürken mtDNA olayını farklı bir teori ile ele aldı..

Hastalıklar mtDNA'nın sarmal haritasında değişik yaparak Sarmal haritatı değiştirdiğini bilmen lazımdır.Şuanda genetik bilimadamları DNA,RNA ve mtDNA üzerinde hastalık yapan genleri buluyorlar.Ona göre tedavi geliştirme yolunda ilermeye çalışıyor..

GENLERE BAĞLI HASTALIKLAR
Renk körlüğü: X kromozomu üzerinde taşınan çekinik bir gen tarafından meydana getirilir. Dişilerde eğer bir çekinik birde baskın karakterde renk körlüğü geni var ise; bunlar hastalık yönünden taşıyıcı olurlar. Hasta olabilmeleri için her iki X kromozomlarında da çekinik renk körlüğü genini taşımaları gerekir. Erkeklerin X genlerinde çekinik gen var ise hasta olurlar. Çünkü bu X kromozomunun homologu olan Y kromozomunda çekinik geni bastıracak gen bulunmaz. Böyle insanlar kırmızı ve yeşil renkleri birbirine karıştırırlar.
Hemofili (kanın pıhtılaşmaması) hastalığı: Bu hastalık geni de tıpkı renk körlüğü geni gibi X kromozomunda çekinik olarak taşınır. Hastalığın meydana gelme mekanizması aynıdır. Bu hastalığı taşıyan insanların kanları pıhtılaşmaz, dolayısıyla kanamalar bunlar için büyük problem oluşturur. Dışarıdan eksik olan moleküller verilerek normal yaşamlarını sürdürmeleri sağlanabilir.
Kas erimesi: Yukarıdaki hastalıklar gibi X kromozomunda çekinik olarak taşınır. Bu geni bulunduran hasta erkekler eşeysel üreme olgunluğuna erişemeden öldükleri için kadınlar hiç bir zaman hasta olmaz, en fazla taşıyıcıdırlar. Normal bir doğumla meydana gelen erkek bebekler 4-5 yaş civarında hastalığın etkisini hissetmeye başlarlar. Kasların aşırı şekilde erimesi büyük kilo kaybına ve nihayetinde 13-15 yaş civarında ölümlerine neden olur.
Balık pulluluk: Y kromozomunda taşınan bir gen tarafından meydana getirilir. Bu yüzden sadece erkeklerde görülür. Hasta olan babanın bütün erkek çocukları bu geni taşıyacaklarından hepsi hasta olur. Bu hastalıkta erkeklerin özellikle kol ve bacakları olmak üzere vücutları tıpkı bir balık gibi pullarla kaplıdır.

Rekombinant gen teknolojisindeki son gelişmelerle birlikte genomik DNA parçalarının klonlanması ve karakterizasyonuyla detaylı bir gen haritası elde etmek mümkün hale gelmiştir. Sonuçta da sadece gen yapısı hakkında bir kaynak olmakla kalmayan aynı zamanda genomda dizi organizasyonu, gen ve genomların evrimi hakkında da son derece değerli bir kaynak olan tüm bir genomun DNA dizisinin elde edilmesi mümkündür. Günümüzde, pekçok model organizmanın örneğin; bakteri, S.cerevisiae, C.elegans, D.melanogaster, F.rubripes, D.rerio, insan gibi organizmaların genetik ve fiziksel haritalarını çıkararak sonuçta, tüm genom dizilerinin saptanmasını amaçlayan çok yoğun bir şekilde devam eden bir uluslararası işbirliği sürmektedir ve bu model organizmaların bazılarının tüm genom dizi analizi tamamlanmıştır (Tablo II) (18). Genomların haritalanması, analizi ve dizi analizi ile ilgili disipline “genomiks„ adı verilmiştir.


Saygımlarımla MeTeE

aydoe
06-07-2009, 22:36
Sayın Mete

Üç ayrı makaleden alıntılayarak asmış olduğunuz iletide ne anlatmaya çalıştığınızı anlayamadım ,ama makalelerin tümünü verseniz ya da linkini verseniz okuyanlar bilgilenebilirler.
Örneğin son paragrafı aldığınız makalenin linkini verseniz ve makalenin devamında yazarın bu çalışmaların '' insan ırklarının evrimleri ve ırkların dünya üzerinde göç yollarının çıkarılması mümkün olacaktır.'' dediğini de okuyabileceğiz.



Rekombinant gen teknolojisindeki son gelişmelerle birlikte genomik DNA parçalarının klonlanması ve karakterizasyonuyla detaylı bir gen haritası elde etmek mümkün hale gelmiştir. Sonuçta da sadece gen yapısı hakkında bir kaynak olmakla kalmayan aynı zamanda genomda dizi organizasyonu, gen ve genomların evrimi hakkında da son derece değerli bir kaynak olan tüm bir genomun DNA dizisinin elde edilmesi mümkündür. Günümüzde, pekçok model organizmanın örneğin; bakteri, S.cerevisiae, C.elegans, D.melanogaster, F.rubripes, D.rerio, insan gibi organizmaların genetik ve fiziksel haritalarını çıkararak sonuçta, tüm genom dizilerinin saptanmasını amaçlayan çok yoğun bir şekilde devam eden bir uluslararası işbirliği sürmektedir ve bu model organizmaların bazılarının tüm genom dizi analizi tamamlanmıştır (Tablo II) (18). Genomların haritalanması, analizi ve dizi analizi ile ilgili disipline “genomiks„ adı verilmiştir.


Saygımlarımla MeTeE

http://www.genetikbilimi.com/gen/genharitalamasi.htm

Rekombinant gen teknolojisindeki son gelişmelerle birlikte genomik DNA parçalarının klonlanması ve karakterizasyonuyla detaylı bir gen haritası elde etmek mümkün hale gelmiştir. Sonuçta da sadece gen yapısı hakkında bir kaynak olmakla kalmayan aynı zamanda genomda dizi organizasyonu, gen ve genomların evrimi hakkında da son derece değerli bir kaynak olan tüm bir genomun DNA dizisinin elde edilmesi mümkündür. Günümüzde, pekçok model organizmanın örneğin; bakteri, S.cerevisiae, C.elegans, D.melanogaster, F.rubripes, D.rerio, insan gibi organizmaların genetik ve fiziksel haritalarını çıkararak sonuçta, tüm genom dizilerinin saptanmasını amaçlayan çok yoğun bir şekilde devam eden bir uluslararası işbirliği sürmektedir ve bu model organizmaların bazılarının tüm genom dizi analizi tamamlanmıştır (Tablo II) (18). Genomların haritalanması, analizi ve dizi analizi ile ilgili disipline “genomiks„ adı verilmiştir.
Tüm dünyada binlerce bilim adamının yaklaşık 15 yıl süren çabaları sonucunda insan DNA`sının hemen hemen tamamlanmış nukleotid dizisi yani haritası ortaya çıkmıştır. Gen haritaları sayesinde bitki ve hayvan üreticileri genetik olarak iyileştirilmiş kalitede üretim yapabilirken, insan genom haritasının çıkarılması açısından bakıldığında, biyokimyasal temeli bilinmeyen genetik hastalıklara neden olan genlerin özgül bir kromozom ya da kromozom bantı üzerine haritalanması, soyağaçları üzerinde bir marker ile olan bağlantısına dayanarak bu genin izinin sürülmesi (gene tracking), hastalığın tedavi edilmesi, insan ırklarının evrimleri ve ırkların dünya üzerinde göç yollarının çıkarılması mümkün olacaktır.

Nurten AKARSU
Hacettepe Üniversitesi, Çocuk Sağlığı ve Hastalıkları Araştırma Merkezi, Gen Haritalama Laboratuvarı
e-mail: nakarsu@hacettepe.edu.tr (nakarsu@hacettepe.edu.tr)
Güven LÜLECİ
Akdeniz Üniversitesi Tıbbi Biyoloji ve Genetik Anabilim Dalı

metee
07-07-2009, 19:17
Sayın Mete

Üç ayrı makaleden alıntılayarak asmış olduğunuz iletide ne anlatmaya çalıştığınızı anlayamadım ,ama makalelerin tümünü verseniz ya da linkini verseniz okuyanlar bilgilenebilirler.
Örneğin son paragrafı aldığınız makalenin linkini verseniz ve makalenin devamında yazarın bu çalışmaların '' insan ırklarının evrimleri ve ırkların dünya üzerinde göç yollarının çıkarılması mümkün olacaktır.'' dediğini de okuyabileceğiz.





http://www.genetikbilimi.com/gen/genharitalamasi.htm

Rekombinant gen teknolojisindeki son gelişmelerle birlikte genomik DNA parçalarının klonlanması ve karakterizasyonuyla detaylı bir gen haritası elde etmek mümkün hale gelmiştir. Sonuçta da sadece gen yapısı hakkında bir kaynak olmakla kalmayan aynı zamanda genomda dizi organizasyonu, gen ve genomların evrimi hakkında da son derece değerli bir kaynak olan tüm bir genomun DNA dizisinin elde edilmesi mümkündür. Günümüzde, pekçok model organizmanın örneğin; bakteri, S.cerevisiae, C.elegans, D.melanogaster, F.rubripes, D.rerio, insan gibi organizmaların genetik ve fiziksel haritalarını çıkararak sonuçta, tüm genom dizilerinin saptanmasını amaçlayan çok yoğun bir şekilde devam eden bir uluslararası işbirliği sürmektedir ve bu model organizmaların bazılarının tüm genom dizi analizi tamamlanmıştır (Tablo II) (18). Genomların haritalanması, analizi ve dizi analizi ile ilgili disipline “genomiks„ adı verilmiştir.
Tüm dünyada binlerce bilim adamının yaklaşık 15 yıl süren çabaları sonucunda insan DNA`sının hemen hemen tamamlanmış nukleotid dizisi yani haritası ortaya çıkmıştır. Gen haritaları sayesinde bitki ve hayvan üreticileri genetik olarak iyileştirilmiş kalitede üretim yapabilirken, insan genom haritasının çıkarılması açısından bakıldığında, biyokimyasal temeli bilinmeyen genetik hastalıklara neden olan genlerin özgül bir kromozom ya da kromozom bantı üzerine haritalanması, soyağaçları üzerinde bir marker ile olan bağlantısına dayanarak bu genin izinin sürülmesi (gene tracking), hastalığın tedavi edilmesi, insan ırklarının evrimleri ve ırkların dünya üzerinde göç yollarının çıkarılması mümkün olacaktır.

Nurten AKARSU
Hacettepe Üniversitesi, Çocuk Sağlığı ve Hastalıkları Araştırma Merkezi, Gen Haritalama Laboratuvarı
e-mail: nakarsu@hacettepe.edu.tr (nakarsu@hacettepe.edu.tr)
Güven LÜLECİ
Akdeniz Üniversitesi Tıbbi Biyoloji ve Genetik Anabilim Dalı

2 Makaleden neden Alıntı yaptığımı anlatan yazı yukarıda yazıyor..

Hastalıklar mtDNA'nın sarmal haritasında değişik yaparak Sarmal haritayı değiştirdiğini bilmen lazımdır.Şuanda genetik bilimadamları DNA,RNA ve mtDNA üzerinde hastalık yapan genleri buluyorlar.Ona göre tedavi geliştirme yolunda ilermeye çalışıyor.. (Küçük kısmı)


EVRİMİN ÇARESİZ KALDIĞI NOKTALARDA MUTASYONA SARILDIĞINI VE mtDNA ÜZERİNDEN GEN SİLME VEYA DEĞİŞTİRMEK İÇİN UĞRAŞTIKLARINI ANLATIYORUM.Diğer tarafdan bilimadamları (EVRİMCİLERE GÖRE TÜM BİLİMADAMLARI DARWİNİN TEORİSİ DESTEKLİYOR.EVRİMCİ DEĞİLSE BİLİMADAM DEĞİLDİR. ) tarafında sadece hastalıklar için gen araştırmasını aktardım.


Saygılarımla..MeTeE

Ayejj
10-07-2009, 13:14
Sn metee,

Ben anlatmaya çalıştım fakat öğrenmeni sağlıyamadım anlaşılan .Konuyu baştan itibaren okursan mitokondri DNA sı üzerinden anlatılmaya çalışılan şeyi daha rahat anlayacaksın.

Bir dahada böyle konuyla alakasız iletileri asma hepsi çöpe gider.

metee
11-07-2009, 23:22
Sn metee,

Ben anlatmaya çalıştım fakat öğrenmeni sağlıyamadım anlaşılan .Konuyu baştan itibaren okursan mitokondri DNA sı üzerinden anlatılmaya çalışılan şeyi daha rahat anlayacaksın.

Bir dahada böyle konuyla alakasız iletileri asma hepsi çöpe gider.

Sn Ayejj

Sen neyi anlatıyorsun ki anlamadım..
mtDNA'yı ne olduğunu bilmeden bana laf söylemek istiyorsun..
mtDNA diğer yazılarda anlatım gibi anlamadın galiba mutasyon üzerinde evrime yarıyor..Ama mutasyon geçiren canlılar evrimce kabul görüyor..Bilimadamları mutasyon geçiren canlılarını hiçbir canlı sınıfına atmıyor..Sen ne anlattın ki ben anlamadım..İlk önce yazdığım son konuya bak sonra cevap ver..Sn aydoe cevap vermediği için bekledim.Yoksa yazımın devamı geliyor.Acele etme sizin gibi sallama gibi teoriye inanmadığımız için biz araştırarak cevap veriyoruz..Yukarıda ne yazdım..

2 Makalede alıntı yaptığımı söylemişti.Neden alıntı yaptığımı söyledim..Alt kısımdaki yazı onu açıklıyor..

EVRİMİN ÇARESİZ KALDIĞI NOKTALARDA MUTASYONA SARILDIĞINI VE mtDNA ÜZERİNDEN GEN SİLME VEYA DEĞİŞTİRMEK İÇİN UĞRAŞTIKLARINI ANLATIYORUM.Diğer tarafdan bilimadamları (EVRİMCİLERE GÖRE TÜM BİLİMADAMLARI DARWİNİN TEORİSİ DESTEKLİYOR.EVRİMCİ DEĞİLSE BİLİMADAM DEĞİLDİR. ) tarafında sadece hastalıklar için gen araştırmasını aktardım.

Saygılarımla..MeTeE

Ayejj
12-07-2009, 12:23
Sn Ayejj

Sen neyi anlatıyorsun ki anlamadım..
mtDNA'yı ne olduğunu bilmeden bana laf söylemek istiyorsun..
mtDNA diğer yazılarda anlatım gibi anlamadın galiba mutasyon üzerinde evrime yarıyor..

Bak şimdi bilim adamları mtDNA üzerindeki mutasyonlara dünya üzerine yayılmış modern insanlar gruplarının göç yollarını ve hangi grupların hangi gruplarla akraba olduğunu tespit etmek için bakıyorlar.Gruplar Hangi zaman aralıklarında birbirinden ayrılmış bunları buluyorlar.

Ama mutasyon geçiren canlılar evrimce kabul görüyor..Bilimadamları mutasyon geçiren canlılarını hiçbir canlı sınıfına atmıyor..Sen ne anlattın ki ben anlamadım..

Sana daha öncede ifade etmeye çalıştım.Evrimcilerin homo sapience 'in mtDNA üzerindeki mutasyonlar sonucu ortaya çıktığını söyleyen bir iddiaları yoktur. Bu senin kendi kendine uydurduğun veya veya uydurmuş olan başkalarından kopyaladığın yanlış bir bilgi.

İlk önce yazdığım son konuya bak sonra cevap ver..Sn aydoe cevap vermediği için bekledim.Yoksa yazımın devamı geliyor.Acele etme sizin gibi sallama gibi teoriye inanmadığımız için biz araştırarak cevap veriyoruz..Yukarıda ne yazdım..
2 Makalede alıntı yaptığımı söylemişti.Neden alıntı yaptığımı söyledim..Alt kısımdaki yazı onu açıklıyor..

İlk önce sen cevap yazdığın konuda ne anlatılıyor onu oku anlamaya çalış sonra sağdan soldan kırpmaya çalıştığın cevapların içerikle uyumluysa onlarında sadece linklerini yapıştır.

aydoe
12-07-2009, 13:08
Sn aydoe cevap vermediği için bekledim.Yoksa yazımın devamı geliyor.Acele etme sizin gibi sallama gibi teoriye inanmadığımız için biz araştırarak cevap veriyoruz..


Sevgili Metee sen bilim adamımısın neyi araştırmaktasın?
İnternetten yazılar bulup ordan 3-4 paragraf araklayarak söylemlerine dayanak olarak sunmak araştırmamıdır?
Bilim evrimi kabul ediyor ve evrim araştırmaları devam ediyor ama bilim yaratılış diye bir şey kabul etmiyor.
Zaten yaratılışı kabul etse araştırmalara son verir Tanrı canlıları yaratmıştır der ve bu konuya noktayı koyar.
Değişimin sürekliliğini gözlemleyebilmekteyiz ve evrim halen devam ediyor.
Gördüklerimize ve bilimsel gerçeklere mi yoksa bilimsel gerçekleri uydurmasyonla çürütmeye çalışan ve bilimle ilgisi olmayan yaratılışçılara mı inanalım?

metee
12-07-2009, 21:51
mtDNA "07-02-2007, 02:07 " hakkında ilk bilgilerin verildiği tarihde liopleurodon arkadaşa bilgileri yazmıştım..Adem - Havva olayını bir benzeri olduğunu yazmıştım.. Araştırmak suç değildir.


Mitokondriyal DNA.
Genleri fosil olarak düşünün.Hücrelerde, bilinen DNA dışında, mitokondri denilen enerji motorlarında ayrı bir DNA halkası var. Mitokondriyal DNA (mtDNA), bilinen –çekirdekte bulunan ve eşeyli üreme sırasında parçalanıp yeniden birleşen– DNA'dan farklı olarak, anneden çocuğa bir bütün olarak geçer."

***mtDNA göre insanların atası ayrı kıtalardan gelmişlerdir..Yani bir Eskimo ve Aborjin nasıl ayrı kalmışlardır, diye bir tabloda kullanıyorlar..Bu olguyu ortaya atan kişi fosillerde mtDNA alması gerektini söylüyor..

**mtDNA göre atalarımız aynı kıtalardan değilde ayrı kıtalardan gelmiştir...Buna kim inanır bilmem...

"Hatalar o kadar yaygın olabilir ki genetikçiler insan popülasyonları ve evrim çalışmalarında yanlış sonuçlara varıyor olabilirler. Forster’ın, dizilimlerin değişimine göre oluşturulan evrim ağaçlarını kapsayan hata-araştırma yöntemi, bu hataların çapını eksik tahmin ediyor olabilir."
Carina Dennis
EDİT....
BU HASTALIKLAR GİBİ BİRÇOĞUNUN BİTKİ TÜRLERİNDE GEÇİŞ OLMADIĞINI GENETİK UZMANLARCA BELİRTİLMİŞTİ.HASTALIK GEÇİŞLERİ SABİT OLAN CANLI TÜRÜ OLAN AĞAÇLAR VE KÜÇÜK BİTKİ TÜRLERİNDE GEÇİŞ İMKANSIZ OLDUĞUDUR.SABİT OLAN CANLI TÜRLERİ YANİ AĞAÇLAR VE DİĞER KÜÇÜK BİTKİ TÜRLERİNE EVRİM GEÇİRME OLANAĞI VERMEZ..O ZAMAN mtDNA GEN KODLARINA GÖRE İNSAN AĞAÇ GRUPLARINDA GELDİĞİNE GÖRE AĞAÇLAR VE DİĞER KÜÇÜK BİTKİ TÜRLERİNDE HASTALIKLAR OLMASI LAZIMDIR.HASTALIKLARIN OLMADIĞI SÖYLEMEK İMKANSIZ OLMAKTADIR.ÇÜNKÜ BİLİMADAMLARI HASTALIKLARIN HANGİ DÖNEM İÇERİSİNDE YAYILDIĞINI TAMAM OLARAK BİLMEDİĞİ İÇİN ARAŞTIRMA SIRASINDA HİÇBİR SABİT CANLI TÜRÜNDE BU HASTALIK GENLERİ BULUNMAMIŞTIR..YUKARIDAKİ GEN KODLARINA GÖRE HASTALIKLARIN BAZILARI VERİLMİŞTİR.

EDİT..

Bu hayvanlar niye yaşıyor..Niye kendini savunuyor..Niye birbirlerine benziyor..
Güzel kardeş TANRI tek insanları yaratsaydı..Darwin olmayacaktı..

Hatam olmuşsa af ola..TŞKLR...

Kendine güveniyorsan bildiğini sorgularken, sorduğun sorunun cevabını aldığına tam tatmin olunca kadar sorgula o zaman istediğin cevaplar seni bulacaktır.......?

Cevapları uzaklaştırmak değil yakınlaştırmak daha iyi bir sonuç verecektir..

Sana profesörler değil kendin olarak yetersin..Yeterki kendi bildiğini sorgularken M harfini değiştirerek değil..Değiştirmeden yapmaktır...M Harfi M kalacaktır..O zaman zorlanmazsın..

metee
12-07-2009, 22:32
"""
Am J Hum Genet 1990 Mar;46(3):613-23

Amerindian mitochondrial DNAs have rare Asian mutations at high frequencies, suggesting they derived from four primary maternal lineages.

Schurr TG, Ballinger SW, Gan YY, Hodge JA, Merriwether DA, Lawrence DN, Knowler WC, Weiss KM, Wallace DC

Department of Biochemistry, Emory University School of Medicine, Atlanta, GA.

The mitochondrial DNA (mtDNA) sequence variation of the South American Ticuna, the Central American Maya, and the North American Pima was analyzed by restriction-endonuclease digestion and oligonucleotide hybridization. The analysis revealed that Amerindian populations have high frequencies of mtDNAs containing the rare Asian RFLP HincII morph 6, a rare HaeIII site gain, and a unique AluI site gain. In addition, the Asian-specific deletion between the cytochrome c oxidase subunit II (COII) and tRNA(Lys) genes was also prevalent in both the Pima and the Maya. These data suggest that Amerindian mtDNAs derived from at least four primary maternal lineages, that new tribal-specific variants accumulated as these mtDNAs became distributed throughout the Americas, and that some genetic variation may have been lost when the progenitors of the Ticuna separated from the North and Central American populations.

"""

Bu yazıya göre Amerikadaki İNSAN türleri 4 ana anneden gelmiştir.

the Asian-specific deletion between the cytochrome c oxidase subunit II (COII) and tRNA(Lys) genes was also prevalent in both the Pima and the Maya.

Bu kısımda Amerika türleri Asyadan geldiğini ve bazı genlerin değiştiğini anlatmaktadır.

Biz yukarıda anlatmak istediğimiz anlatamadık galiba biz insan göç teorisi ilk Türklerde görülmüştür..Mustafa Kemal Atatürk bu konuda araştırmaları mevcuttur.Kendisi Türklerin Mu kayıp kıtadan geldiğini söylemiştir.Evrimciler Türklerin göçlerini kullanarak yeni bir teori ortaya atıyor. Bu teorinin temelinde Eskimolar, Kızılderiler, mayalar ve azteklerin yaşayış tarzına göre hazırlanmıştır.

Neden bu insan grupları evrim geçirmek istesin ki?

Neden kendi kültür tarzlarını bırakmak istesin ki?

Neden bir maymun kendi yaşam tarzı değiştirmek için uğraşsın ki?

Neden Darwin sudan karaya geçiş yapsın ki?



"""Amerindian mitochondrial DNAs have rare Asian mutations at high frequencies, suggesting they derived from four primary maternal lineages."""

""""Ayejj""""ALINTI"""" Sana daha öncede ifade etmeye çalıştım.Evrimcilerin homo sapience 'in mtDNA üzerindeki mutasyonlar sonucu ortaya çıktığını söyleyen bir iddiaları yoktur. Bu senin kendi kendine uydurduğun veya veya uydurmuş olan başkalarından kopyaladığın yanlış bir bilgi."""""


Saygılarımla..MeTeE

EDİT....

metee
12-07-2009, 23:38
Neanderthal nedir.

""""Homo neanderthalensis, l milyon yıl önce Avrupa’ya yerleşmiş olan Homo
heidelbergensis soyundan türemiştir. Hangi fosil örneklerinin hangi türe ait
olduğu antropologlar arasında tartışmalıysa da, klasik Neanderthal
niteliklerinin 150 bin yıl önce geliştiği bellidir.

Bunlar arasında epey iri ve uzun burunlu, kalın kaş çıkıntılı bir yüz ve çağdaş
insanın yüksek ve yuvarlak kafatasıyla kıyaslandığında düz ve eğik bir kafatası
vardır. Gövdeleri iri ve güçlü, göğüsleri geniş olup adaleli kol ve bacakları
vardı. Kemiklerinin kalın ve ağır olması büyük fiziki faaliyet gerektiren yorucu
bir hayatları olduğunu göstermektedir."""

http://www.mailce.com/neanderthallere-ne-oldu.html Tam metni

Neanderthal evrimciler tarafında Yamyamlık, dinsellik eksikliği, şiddet, zeka eksikliği, konuşması için yetersizlik vs gibi kötü karakteristiklerle anmaya başladılar.Sonra Neanderthallerin aileleri terk eden yarı yamyam yarı insan kişiliği olna bir grup olarak göstermeye başladılar.Başka zaman grafiğinde evrimci bilimadamları Neanderthalleri insandan ayrı bir ırk olduğunu söyledi.Neanderthaller evrimciler için ilk modern insan olarak kabul gördü.Belli bir zaman sonra değişik fosilller bulundukça yeni modern insan grubu değişti.Asya,Kuzey, Doğu, Batı ve En son güney Afrikada bulunan fosiller sayesinde modern insan Güney Afrikaya gitti..
https://genographic.nationalgeographic.com/genographic/atlas.html Bu linklerde bulunan fosiller hakkında bilgiler mevcuttur..

Güney Afrikada bulunan Fosiller hakkında https://genographic.nationalgeographic.com/genographic/atlas.html bilgi mevcuttur..

Son bulunan fosiller yanında insanı işaret eden bir takım malzemeler bulunmuştur..Diğer bir kemik veya bir diş örneği ile hayal edilerek isim verilmiştir.

Neanderthal evrimciler için büyük bir sarsıntı oldu ilk önce insan olmakta sonralarda en kötü karakteristikleriyle kötülemeye başladılar..Çünkü evrimciler modern insan grubu teorisi Asya, Avrupa ve Afrika üzerinde geçmişti.Neanderthalleri buldukları yılllarda fazla fosiller olmaması onuları sıkıntıya soktu.Bu önyargılar ve bulunan birçok yeni fosillerle kaybolmaya başlaması nedeninden dolayı bizim gerçek atalarımız olarak Neanderthallar'ı kabul etmek için çok zordu. Mitochondrial DNA araştırmasında bilim adamlarını şaşırtacak şekilde farklı niteliklerinden dolayı Neanderthal tekrar dışlanacaktı.Bilimadamları Neanderthal mtDNA olayında ayrı tutmaya başladılar..Evrimciler Neanderthal gruplarını üvey evlat gibi dışladılar.Atalarımız olmazdı..Çünkü mtDNa genlerine göre Neanderthal devamı niteliğinde Aborjinleri olması ve diğer başka insan gruplarının Neanderthal gruplarından gelme olasılığı yüksek oluyor.Çünkü şuanda Eskimo, Kızılderiler ve Aborjinler aynı genler üzerinde gelmesi lazımdır.Günümüzdeki genetik evrimci bilimadamları havva teorisi bu şekilde kendileri tarafında bitirilmişti.Neanderthal hangi grubu oluşturması lazım diye düşünen evrimci bilimadamları en son Neanderthal gruplarını insan grubunda çıkarmak veya nesli tükenmiş insan grubu yapmıştır..


"Neanderthals Modern insan farklıdır - onlar gibi Afrikalılar veya Avustralyalılar bu DNA'ları olarak Avrupalılar farklıdır."


Neanderthal ilk bulunan fosil üzerinde genetik araştırma yapıldı, Vindija Mağarası, Hırvatistan bulundu.

Şimdiye kadar, Neanderthal kemikleri gelen DNA yalnızca iki numune analiz edilmiştir.



Saygımlarımla...MeTeE

Ayejj
13-07-2009, 14:07
"""
Am J Hum Genet 1990 Mar;46(3):613-23

Amerindian mitochondrial DNAs have rare Asian mutations at high frequencies, suggesting they derived from four primary maternal lineages.

Schurr TG, Ballinger SW, Gan YY, Hodge JA, Merriwether DA, Lawrence DN, Knowler WC, Weiss KM, Wallace DC

Department of Biochemistry, Emory University School of Medicine, Atlanta, GA.

The mitochondrial DNA (mtDNA) sequence variation of the South American Ticuna, the Central American Maya, and the North American Pima was analyzed by restriction-endonuclease digestion and oligonucleotide hybridization. The analysis revealed that Amerindian populations have high frequencies of mtDNAs containing the rare Asian RFLP HincII morph 6, a rare HaeIII site gain, and a unique AluI site gain. In addition, the Asian-specific deletion between the cytochrome c oxidase subunit II (COII) and tRNA(Lys) genes was also prevalent in both the Pima and the Maya. These data suggest that Amerindian mtDNAs derived from at least four primary maternal lineages, that new tribal-specific variants accumulated as these mtDNAs became distributed throughout the Americas, and that some genetic variation may have been lost when the progenitors of the Ticuna separated from the North and Central American populations.

"""

Bu yazıya göre Amerikadaki İNSAN türleri 4 ana anneden gelmiştir.

the Asian-specific deletion between the cytochrome c oxidase subunit II (COII) and tRNA(Lys) genes was also prevalent in both the Pima and the Maya.

Bu kısımda Amerika türleri Asyadan geldiğini ve bazı genlerin değiştiğini anlatmaktadır.



Baştan itibaren konuyu okumanı işte bu yüzden ısrarla belirttim.Bu verilere ilişkin şeyler ve açıklamala zaten yazıdada var.Fakat bunlar mtDNA üzerinden elde edilen sonuçları çürütmüyor.Buyrun bakın.



Amerika’ya yerleşim

Bu gruplar Amerika’ya yayılıp çoğaldıklarında, kemikleşmiş çok milliyetli bir Birleşmiş Milletler ekibi gibi hareket etmedi. Yeni gelenler Yeni Dünya’da kök saldıklarında yeşeren kültürlerin kökeni çeşitli Asya anayurtlarından gelen ayrı ve kendine has fiziksel, genetik ve kültürel öğelere dayanıyordu. Bu tablo arkeolojik kanıtlarla destekleniyor gibi gözüküyor. Clovis öncesi dönemden kalma insan izleri için sürdürülen araştırmalar sonucunda, kuzey ve güney Amerika’da Clovis katmanlarının altından ve daha erken dönemin Clovis olmayan yerleşim yerlerinden bazı aletler çıktı. Bu aletler Clovis’ten tümüyle farklı geleneklerden geliyordu ve Asya yakasında değişik benzerlere sahipti. Değişik kültürlerin birbirine paralel kolonizasyonlarından beklediğimiz
de budur.

İlk Amerikan topluluklarının farklı fiziksel görünümlerinden ötürü, onlar arasında açık genetik farklılıklar görmeyi ummamız gerek. Torroni ve Wallace’ın not ettikleri üzere mtDNA alt gruplarının kabilesel farklılıkları için belirgin olan eğilimde böyle değişiklikler görülmektedir. Amerikalar’ın tek aşamada kolonizasyonunun kanıtlarından biri kuzey, orta ve güney Amerika’da A, B, C ve D majör gruplarının her zaman bulunuşu olmuştur.



Neden bu insan grupları evrim geçirmek istesin ki?

Neden kendi kültür tarzlarını bırakmak istesin ki?

Neden bir maymun kendi yaşam tarzı değiştirmek için uğraşsın ki?

Neden Darwin sudan karaya geçiş yapsın ki?

Hiçbir canlı sipariş usulü evrim geçirmez.Bir kere evrimin felsefesini kavramamışsın.
Canlılar uğradıkları doğal seleksiyonun baskısı sonucu seçilime uğrarlar.




"""Amerindian mitochondrial DNAs have rare Asian mutations at high frequencies, suggesting they derived from four primary maternal lineages."""

""""Ayejj""""ALINTI"""" Sana daha öncede ifade etmeye çalıştım.Evrimcilerin homo sapience 'in mtDNA üzerindeki mutasyonlar sonucu ortaya çıktığını söyleyen bir iddiaları yoktur. Bu senin kendi kendine uydurduğun veya veya uydurmuş olan başkalarından kopyaladığın yanlış bir bilgi."""".

Aklın sıra bana cevap verdiğni zannediyorsun dilaver'den alıntıladığım yeri oku.

metee
13-07-2009, 19:16
Benim yazıları Edit edip düzenleme yapacağına yazılarımın orjinal haliyle bıraksadın..

49- Büyük Harflerle Yazmayınız Büyük harflerle yazmak internet dilinde bağırmak anlamına gelir. Bu nedenle çok gerekmedikçe büyük harflerle mesajlarınızı yazmayınız. Büyük harflerle yazılan mesajlar silinerek üye uyarılacaktır. Tekrarı durumunda disiplin cezası verilecektir.

Sana profesörler değil kendin olarak yetersin..Yeterki kendi bildiğini sorgularken M harfini değiştirerek değil..Değiştirmeden yapmaktır...M Harfi M kalacaktır..O zaman zorlanmazsın..

metee
13-07-2009, 19:56
prozac02 yazılarım da bu şekilde uyarı verdiğin için sana tşk ederim..

Diğer arkadaşlar gibi EDİT yazmadığın için tşklr



EDİT ne anlama geliyor..




Bu hayvanlar niye yaşıyor..Niye kendini savunuyor..Niye birbirlerine benziyor..
Güzel kardeş TANRI tek insanları yaratsaydı..Darwin olmayacaktı..

Hatam olmuşsa af ola..TŞKLR...

Kendine güveniyorsan bildiğini sorgularken, sorduğun sorunun cevabını aldığına tam tatmin olunca kadar sorgula o zaman istediğin cevaplar seni bulacaktır.......?

Cevapları uzaklaştırmak değil yakınlaştırmak daha iyi bir sonuç verecektir..

Sana profesörler değil kendin olarak yetersin..Yeterki kendi bildiğini sorgularken M harfini değiştirerek değil..Değiştirmeden yapmaktır...M Harfi M kalacaktır..O zaman zorlanmazsın..

Ayejj
14-07-2009, 13:36
Evrim karşıtı yazarların bir kısmının yazdığı iletilere saygı duyarım.

Yanlışda düşünüyor olsalar evrim karşıtlarının bir kısmı onlara anlatmak istediğinizi anlar ve ne söylediğinide siz anlarsınız.

Çünkü adam hasbel kader konuyla ilgili birşeyler biliyordur.Böylesine can kurban başımın üstünde yeri var.

Birde 2. tip erim karşıtları var .Onlar Hem bir şey bilmezler hemde öğrenmek adına en ufak bir çabalarıda yoktur.Ancak bir iki yerden kırpıştırdıkları (oralardada ne anlatıldığını analamadıkları halde) şeylerle evrim teorisini çürüttüklerini sanırlar.

metee bir takım çürük iddialarda bulunuyordun bende kounuyu okumadan salladığını gösterdim.Her halde sancın bundan olsa gerek.

İşte derin ingilizce bilginle evrimim çürüttüğünü zannetiğin şu cümle

"""Amerindian mitochondrial DNAs have rare Asian mutations at high frequencies, suggesting they derived from four primary maternal lineages."""

Şimdi aşagıdaki alıntıyı oku bakıyım.

Kuzey Amerika'nın yeniden İstilası
12.500 – 10.000 yıl önce

Amerikan Kutup bölgesi ve Kuzey Kutupaltı’ndaki kolonizasyonları, iki kıtanın geri kalan bölgelerinde yaşayanlarla Asya’dan yapılmış tek bir göç üzerinden ilişkilendirmeye çalışanların karşı karşıya kaldığı bir başka çözülmemiş sorun da, atasal gen gruplarının dağılımındaki dengesizliktir. Atasal grup analizlerinin genel ilkesine ve aynı zamanda evrimin pratik bir kuralına göre, göçün kaynağına ne kadar yaklaşırsanız, ata genlerin tümünü bulmanız o kadar güçlü bir olasılıktır. Bunun aksine, göçün başlangıç noktasından ne kadar uzağa gitmişseniz, çeşitlilik o kadar azalmıştır.

Amerika’da ise tam tersi bir durumla karşı karşıyayız. Amerika’ya göçün başlamış olması gereken yer olan kuzeybatı Alaska’nın yukarısında şu anda, atasal gen kollardan sadece bir tanesi A, A2 tipi şeklinde türemiş olarak bulunmaktadır. Dahası, B ve C ise tüm Kuzey Kutbu ve Kutupaltı boyunca tamamen kaybolmuştur. Bunun tersine, Amerika’nın geri kalanında A ve D atasal grupları çok geniş bir alana yayılmış ve çeşitlenmiş olarak bulunur. Burada bir yanlışlık varmış gibi görünmektedir. Alaska’daki giriş kapısında ve Kanada’nın buraya komşu kesimlerinde bulabildiğimiz şey sadece oldukça genç A2 maternal klanı iken, nasıl olur da, Amerika’da A, B, C ve D’nin tümü yaygın olarak bulunabilir?

Birçok bakımdan, kuzey Amerika’nın güney yarısındaki zengin genetik çeşitlilik, onunla başa baş giden güney Amerika’daki çeşitlilik ve kuzeyin en uç noktasında (Kanada ve Alaska) en alt düzeydeki çeşitlilik, dil sayılarının dağılımının tam tersi bir görüntüyü yansıtır. Eğer ilk-Clovis tezi doğru olsa ve ilk yerleşim Son Büyük Buzul Çağı’ndan sonra meydana gelmiş olsaydı, biz tam tersini bulmuş olurduk. İlkel kolonizasyon Buzul Çağı’ndan önce meydana gelmiş olsaydı, kuzey Amerika’nın geniş parçalarının nüfusu bu çağ boyunca azalmış olurdu. Kuzey Amerika nüfusu “büyük erime” boyunca yeniden genişlemişse, kuzey insanları daha düşük bir çeşitlilik gösterir ve sonuç olarak güneydekilerden daha genç bir devirde varolurlardı.

Altüst olmuş görünen bu tür genetik bulguları açıklayabilecek olan “Buz Çağı’ndan sonra kuzey Amerika’daki genişleme evresi” tezi, 1993’te ileri sürülmüştü. Alaskalı genetik bilimci Gerald Shields ve meslektaşları,
Asya’da ve Amerika’daki Kuzey Kutbu çevresi nüfusunun, genetik olarak daha genç, birbirine benzer ve her iki kıtanın daha uzak güney bölgelerindeki nüfustan farklı olduğunu fark ettiler. Özellikle, B Grubu 55. paralelin kuzeyinde hiç yoktu. Kutup çevresi halklarının, genetik çeşitlilikten yoksun tek bir kuzeyli popülasyonun daha yakın zamanlardaki genişlemesiyle meydana gelmiş olabileceğini savundular. Hatta bu genişlemenin, Amerika’nın daha zengin çeşitliliğe sahip bir popülasyon tarafından kolonize edilmesinden daha sonra gerçekleştiğini ileri sürdüler. Düşük genetik çeşitliliğe sahip popülasyonların Buz Çağı’ndan ve Amerika’nın önceki kolonizasyonundan sonra Kanada ve Alaska’daki genişlemesini ileri süren bu görüşün, bu bölgeler tarafından ortaya sürülen çözülmesi zor genetik ve dilbilimsel sorulara cevap olabilmesi için daha uzun bir yol katetmesi gerekiyor gibiydi.

Bu yeniden genişleyen uzak kuzey gruplarının nereden geldiği -Asya’dan mı Amerika’dan mı- sorusu hâlâ ortada duruyordu. Sibiryalı Inuit ve Chukchi’deki A2 varlığı olası bir Asyalı kaynağı ileri sürerken, A1 / A2 bağına işaret eden yeni genetik kanıt Amerika’yı işaret ediyor gibiydi. Yine de, bütün diğer Amerikalılar’ın olduğu gibi, eğer Na-Dene ve Inuit-Aleut de aynı orijinal genetik depodan geliyorsa, bu çağdaki bu denli büyük farklılık ve genetik, fiziksel ve dilsel olarak bu kadar derin bir ayrım, nereden geliyordu?

1996’da, Anglo-Alman genetikçi Peter Forster ve uluslararası bir ekip, bu problem yumağını tutarlı bir açıklamaya kavuşturmak yönünde ilerlediler. Bu, birçok insanın uzunca bir zamandır çözmeye uğraştığı bir satranç problemi gibiydi. Ama yanıt basitti. Forster’ın birlikte çalıştığı insanların arasında, Antonio Torroni ve bir matematikçi ve çok yönlü bir bilimci, aynı zamanda bu harita için kullandığım gerçek gen ağaçlarını yaratmakta gerekli olan analizin çoğunun yaratıcısı ve ilham kaynağı olan Alman Hans-Jurgen Bandelt vardı. Amerika bilmecesinin yanıtı, kuzeyli insanların Buz Çağı’ndaki yurtlarının Asya ya da Amerika değil, başka bir kıta, Beringia olduğu idi.

11.000 ila 25.000 yıl önce, deniz seviyesi o kadar düşüktü ki, Bering Boğazı, Asya ve kuzey Amerika arasında karadan bir köprü durumundaydı. Gerçekte, Beringia bir köprü olmaktan daha fazlasıydı; en geniş uzamıyla 1,3 milyon km2’lik (500 bin mil2) başlı başına büyük bir kıtaydı. Buzla kaplı değildi, dahası tundra otlaklarıyla otçul memeli hayvan sürüleri
için elverişli bir bölgeydi. Yazlar şimdikinden kesinlikle daha serindi,
ama aksine kışlar daha ılıman ve yumuşaktı. Kara köprüsünün varlığını
sürdürdüğü dönemin büyük bölümünde, daha güneyde sürekli olarak
buz tepeleri vardı ve 15.000 ila 20.000 yıl önce aradaki buz koridoru,
muhtemelen Amerika’nın kuzeyi ve geri kalanı ile arasındaki bağlantıyı
engelleyecek şekilde kapalıydı. Sibirya çevresi, o dönemde bir kutup çölü olan kuzey Amerika’dan daha çekici sayılmazdı. Böylece Beringia ve Alaska’nın batı kesimleri, her iki kıtadan da ayrı olarak, fiilen bir Buz Çağı sığınağı haline geldi. Amerika’ya ilk yerleşenlerin özgün genetik yapısından arta kalanları barındıran Beringia sığınağı sayesinde, şimdi, A1 / A2 grubu gen ağacı üzerinden Amerika’yla bağlantısı olan Na-Dene ve Inuit-Aleut’un, neden yoksul çeşitlilikleriyle Amerikalılar’ın geri kalanından epeyce farklı göründüğünü görebiliriz.

Ayrıca bilmeni isterim senin ordan burdan copy paste yaptığın bilimdışı iletileri EDİT lemek benimde hoşuma gitmiyor.

Daha önceki mesajlarına bakanlar EDİT lenen yerlerde ne tür gyazılar olduğunu rahatlıkla anlarlar.O yönden bir sıkıntın olmasın.

metee
17-07-2009, 11:59
Bilim dünyasın sarsan gelişme

Genetik konusunda tüm bilinenler çökebilir, adli tıp DNA testleri tartışmalı hale gelebilir!

Bunun üzerine sağlıklı kişilerden de kan ve doku hücreleri alındı.

Kanadalı bilimadamları, insan vücudundaki kan ve doku hücrelerinde bulunan DNA’ların farklı olduğunu keşfetti. McGill Üniversitesi’nden Dr Morris Schweitzer liderliğindeki bir ekip tarafından yapılan araştırma “Human Mutation” dergisinde yayınlandı.

Bilimadamları, abdominal aort anevrizması (AAA) hastalığının genetik nedenlerini araştırıyordu. Hücrenin ölümünde rol oynayan BAK genini inceleyen uzmanlar, bu genin, kan hücrelerinde ve doku hücrelerinde iki farklı yapıda olduğunu farketti. Bunun üzerine sağlıklı kişilerden de kan ve doku hücreleri alındı. Bu kişilerde de iki farklı DNA yapısı saptandı.

Hastalıkların genetiği, canlılardan doku almak zor olduğu için kan üzerinden yürütülüyordu. Kan ve doku DNA’sının aynı olduğu varsayılıyordu. Araştırmanın doğrulanması halinde, genetik konusunda tüm araştırmaların ve verilerin yeniden gözden geçirilmesi gerekebilir. Bu durumda adli tıp DNA testleri de şüphe uyandırıyor. Doku ve kandan alınan DNA karşılaştırmaları geçerliliğini koruyacak mı, yoksa yeni testler geliştirilmesi mi gerekecek.

HÜRRİYET


Senin ne anladığını görmekteyiz.Saygı istemiyorum sen isteyen olursa ona verirsin.
Yazılanı iyi anlamak lazım edit edilmeden uyarmak lazım.

prozac02 arkadaş yeni yazıda BÜYÜK BÜYÜK harf kullandığım için makale silindi.Orda sana cevap verilmişti.

Aynı yazı copy yap ve yapıştır.

Yukarıdaki yazının hakkında bilgi verilmişti.
Ama sorun değil sağlık olsun..

Kurallar var ise bizde ona göre hareket ederiz.





"""Amerindian mitochondrial DNAs have rare Asian mutations at high frequencies, suggesting they derived from four primary maternal lineages."""


""""Ayejj""""ALINTI"""" Sana daha öncede ifade etmeye çalıştım.Evrimcilerin homo sapience 'in mtDNA üzerindeki mutasyonlar sonucu ortaya çıktığını söyleyen bir iddiaları yoktur. Bu senin kendi kendine uydurduğun veya veya uydurmuş olan başkalarından kopyaladığın yanlış bir bilgi."""""

Saygılarımla...MeTeE


Bu hayvanlar niye yaşıyor..Niye kendini savunuyor..Niye birbirlerine benziyor..
Güzel kardeş TANRI tek insanları yaratsaydı..Darwin olmayacaktı..

Hatam olmuşsa af ola..TŞKLR...

Kendine güveniyorsan bildiğini sorgularken, sorduğun sorunun cevabını aldığına tam tatmin olunca kadar sorgula o zaman istediğin cevaplar seni bulacaktır.......?

Cevapları uzaklaştırmak değil yakınlaştırmak daha iyi bir sonuç verecektir..

Sana profesörler değil kendin olarak yetersin..Yeterki kendi bildiğini sorgularken M harfini değiştirerek değil..Değiştirmeden yapmaktır...M Harfi M kalacaktır..O zaman zorlanmazsın..

metee
17-07-2009, 12:04
metee bir takım çürük iddialarda bulunuyordun bende kounuyu okumadan salladığını gösterdim.Her halde sancın bundan olsa gerek.


O şekilde bi iddaa ile bu foruma geldiğimi hatırlamıyorum.
Ya da
-Buldum.
-Buldum.
-Buldum.
-Darwin'in hatasını buldum.
-Diye bir iddaa yok.

Bilgin ile kal.

Saygımlarımla.. MeTeE

Cevapları uzaklaştırmak değil yakınlaştırmak daha iyi bir sonuç verecektir..

Sana profesörler değil kendin olarak yetersin..Yeterki kendi bildiğini sorgularken M harfini değiştirerek değil..Değiştirmeden yapmaktır...M Harfi M kalacaktır..O zaman zorlanmazsın..

Ayejj
17-07-2009, 19:23
Bilim dünyasın sarsan gelişme

Genetik konusunda tüm bilinenler çökebilir, adli tıp DNA testleri tartışmalı hale gelebilir!

Bunun üzerine sağlıklı kişilerden de kan ve doku hücreleri alındı.

Kanadalı bilimadamları, insan vücudundaki kan ve doku hücrelerinde bulunan DNA’ların farklı olduğunu keşfetti. McGill Üniversitesi’nden Dr Morris Schweitzer liderliğindeki bir ekip tarafından yapılan araştırma “Human Mutation” dergisinde yayınlandı.

Bilimadamları, abdominal aort anevrizması (AAA) hastalığının genetik nedenlerini araştırıyordu. Hücrenin ölümünde rol oynayan BAK genini inceleyen uzmanlar, bu genin, kan hücrelerinde ve doku hücrelerinde iki farklı yapıda olduğunu farketti. Bunun üzerine sağlıklı kişilerden de kan ve doku hücreleri alındı. Bu kişilerde de iki farklı DNA yapısı saptandı.

Hastalıkların genetiği, canlılardan doku almak zor olduğu için kan üzerinden yürütülüyordu. Kan ve doku DNA’sının aynı olduğu varsayılıyordu. Araştırmanın doğrulanması halinde, genetik konusunda tüm araştırmaların ve verilerin yeniden gözden geçirilmesi gerekebilir. Bu durumda adli tıp DNA testleri de şüphe uyandırıyor. Doku ve kandan alınan DNA karşılaştırmaları geçerliliğini koruyacak mı, yoksa yeni testler geliştirilmesi mi gerekecek.

HÜRRİYET


Mitokondri DNA araştırmalarının kan üzerinden yapıldığını zannetmiyorum. Çünkü alyuvarların mitokondrileri yoktur.Alyuvarlar kanın hücre kısmının çok büyük çoğunluğunu meydana getirirler.

Mitokondri açısından en zengin organlar karaciğer ve kaslarımızdır.

MtDNA eğer karaciğer veya kas dokusundan yapıldıysa bu haber sonuçları etkilemez.